Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30279
Trapped Gene
Cpeb2 (ENSMUSG00000039782)
Vector Insertion
Chr 5: 43629656 - 43635824
Public Clones D047E08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363496 (Chr5:43629566..43629655 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGGGGCTCAGATTCACTC Chr5:43629591..43629610 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363496 (Chr5:43629566..43629655 +)
Downstram Exon
ENSMUSE00000391010 (Chr5:43635825..43635915 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGGGGCTCAGATTCACTC Chr5:43629591..43629610 59.8 55 GAGGATCGTGCTCTGCTCTC Chr5:43635912..43635931 60.26 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697995 Chr5:43625195..43625255 AGCAGCCAGAAGAGGAAAGA Chr5:43625206..43625225 59.31 50
upstream ENSMUSE00000446436 Chr5:43625198..43625257 AGCAGCCAGAAGAGGAAAGA Chr5:43625206..43625225 59.31 50
upstream ENSMUSE00000697994 Chr5:43626127..43626327 CTGCAGCAGAGGAACTCGTA Chr5:43626295..43626314 59.34 55
upstream ENSMUSE00000367338 Chr5:43626129..43626327 CTGCAGCAGAGGAACTCGTA Chr5:43626295..43626314 59.34 55
upstream ENSMUSE00000406773 Chr5:43628546..43628827 AGAAGCCGTTCTCGGGTAAT Chr5:43628694..43628713 60.1 50
upstream ENSMUSE00000363496 Chr5:43629566..43629655 CTTGGGGCTCAGATTCACTC Chr5:43629591..43629610 59.8 55

*** Putative Vector Insertion (Chr 5: 43629656 - 43635824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391010 Chr5:43635825..43635915 GAGGATCGTGCTCTGCTCTC Chr5:43635912..43635931 60.26 60
downstream ENSMUSE00000400660 Chr5:43652973..43653023 AGATTGTCGGTTCCTGGATG Chr5:43653012..43653031 59.93 50
downstream ENSMUSE00000697993 Chr5:43660018..43660131 CTCGTCTTCGCCCATAACTC Chr5:43660134..43660153 59.84 55
downstream ENSMUSE00000354848 Chr5:43668670..43668840 GCGTTCAATTCGTTCTCCAT Chr5:43668794..43668813 60.08 45
downstream ENSMUSE00000545891 Chr5:43669843..43669932 TGTGGGGCCAATCTACTACC Chr5:43669902..43669921 59.81 55
downstream ENSMUSE00000289842 Chr5:43672349..43672467 CAATGCAAGCGTCAATGAGT Chr5:43672414..43672433 59.87 45
downstream ENSMUSE00000545889 Chr5:43672610..43672724 TTCCAAGGACGGATTTGAAC Chr5:43672632..43672651 59.91 45
downstream ENSMUSE00000289830 Chr5:43675176..43675357 ATCAATGTCACCGTGCTGAA Chr5:43675354..43675373 60.12 45
downstream ENSMUSE00000592894 Chr5:43676958..43678261 CTGGCACTCGTCACACATCT Chr5:43677011..43677030 59.9 55
downstream ENSMUSE00000599882 Chr5:43676958..43677429 CTGGCACTCGTCACACATCT Chr5:43677011..43677030 59.9 55
downstream ENSMUSE00000697992 Chr5:43676958..43680963 GTATCGAGAGCTGGGTGAGC Chr5:43677310..43677329 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATAATCGCCTTGCAGCAC Chr5:43635703..43635724 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGACCAGGTAGGCTGCACA Chr5:43635649..43635669 59.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039782