Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30287
Trapped Gene
Tnpo2 (ENSMUSG00000031691)
Vector Insertion
Chr 8: 87562389 - 87564360
Public Clones D041E02 (ggtc) D041E02 (ggtc) IST14578F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000480800 (Chr8:87562234..87562388 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCGCCCAACACAGCTACT Chr8:87562351..87562370 59.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000480800 (Chr8:87562234..87562388 +)
Downstram Exon
ENSMUSE00000581298 (Chr8:87564361..87564436 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCGCCCAACACAGCTACT Chr8:87562351..87562370 59.94 55 TCTGATTTGAGTCTGGTCAGGA Chr8:87564435..87564456 59.84 45.46

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606588 Chr8:87560814..87560876 TGGAGAAGCTGCAGCACTTAG Chr8:87560830..87560850 60.85 52.38
upstream ENSMUSE00000480800 Chr8:87562234..87562388 AGTCGCCCAACACAGCTACT Chr8:87562351..87562370 59.94 55

*** Putative Vector Insertion (Chr 8: 87562389 - 87564360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581298 Chr8:87564361..87564436 TCTGATTTGAGTCTGGTCAGGA Chr8:87564435..87564456 59.84 45.46
downstream ENSMUSE00000581297 Chr8:87564513..87564662 CGCCAATGTTGTTGAGACAC Chr8:87564635..87564654 60.16 50
downstream ENSMUSE00000476299 Chr8:87568311..87568417 CTGAGTTGAGCAGGTTGCAC Chr8:87568400..87568419 59.62 55
downstream ENSMUSE00000477305 Chr8:87568501..87568634 AGCTCCGAGGAGTCTTCACA Chr8:87568550..87568569 60.13 55
downstream ENSMUSE00000478044 Chr8:87568725..87568806 TGATGAACTGGTTCACACAGG Chr8:87568761..87568781 59.58 47.62
downstream ENSMUSE00000479084 Chr8:87568882..87569004 CTGTCAATTCGCACTTCCAA Chr8:87568976..87568995 59.84 45
downstream ENSMUSE00000487811 Chr8:87569097..87569215 GCTAGCGTCAGCCAGAACTC Chr8:87569173..87569192 60.31 60
downstream ENSMUSE00000487867 Chr8:87571020..87571080 CTTCATCCCATTCACGAGGA Chr8:87571053..87571072 61 50
downstream ENSMUSE00000489631 Chr8:87571189..87571354 ACTGTGCGTGACTTGTGGAA Chr8:87571268..87571287 60.36 50
downstream ENSMUSE00000490673 Chr8:87571482..87571634 CCACTCAGGGTGGAATAGGA Chr8:87571591..87571610 59.92 55
downstream ENSMUSE00000581296 Chr8:87573835..87574060 CTTGAGGTGCATGTCAGGTG Chr8:87573995..87574014 60.31 55
downstream ENSMUSE00000486009 Chr8:87574258..87574429 CTCCTCCAGGGTAGCAAATG Chr8:87574282..87574301 59.69 55
downstream ENSMUSE00000495246 Chr8:87575437..87575523 CCTTGTCTTCGTCCTTGAGC Chr8:87575506..87575525 59.99 55
downstream ENSMUSE00000514347 Chr8:87575598..87575705 TGGTAGACAGGCTCGCAGTA Chr8:87575665..87575684 59.62 55
downstream ENSMUSE00000515344 Chr8:87575788..87575946 CCAACGCAACAATCATGAAG Chr8:87575854..87575873 60.11 45
downstream ENSMUSE00000494411 Chr8:87577358..87577445 ACAGGGCTTGACGTGGATAA Chr8:87577444..87577463 60.52 50
downstream ENSMUSE00000581295 Chr8:87577655..87577753 CCAGGTAGCATTGTTGCAGA Chr8:87577728..87577747 59.86 50
downstream ENSMUSE00000496264 Chr8:87578225..87578320 TGGGCCTGTTAATGATCTCC Chr8:87578293..87578312 59.89 50
downstream ENSMUSE00000502489 Chr8:87578591..87578696 CTGGAATGGCAGAGGGACTC Chr8:87578623..87578642 62.13 60
downstream ENSMUSE00000492590 Chr8:87578901..87579000 TTGTCCCGGATGTTCCTAAG Chr8:87578933..87578952 59.93 50
downstream ENSMUSE00000505196 Chr8:87579078..87579152 AACATGTCCCGAAGGTCATC Chr8:87579148..87579167 59.79 50
downstream ENSMUSE00000501702 Chr8:87579239..87579366 CTCCCCAACTTGGTCTTTGA Chr8:87579274..87579293 60.08 50
downstream ENSMUSE00000581293 Chr8:87579450..87581479 GTACCAATCTGGCGTGGTCT Chr8:87580587..87580606 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCGCCCAACACAGCTACT Chr8:87562352..87562372 59.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCGCCCAACACAGCTACT Chr8:87562352..87562372 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031691