Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30305
Trapped Gene
Ephb1 (ENSMUSG00000032537)
Vector Insertion
Chr 9: 101969200 - 102097786
Public Clones D024F11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634778 (Chr9:102097104..102097785 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTGTTCCCAGAAACCAT Chr9:102097280..102097299 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634778 (Chr9:102097104..102097785 -)
Downstram Exon
ENSMUSE00000634777 (Chr9:101969201..101969356 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTGTTCCCAGAAACCAT Chr9:102097280..102097299 59.97 50 CTGGTGGATCAAAGTCAGCTC Chr9:101969194..101969214 59.86 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693408 Chr9:102256612..102257022 ACACACCCACCTCTCCCATA Chr9:102256881..102256900 60.24 55
upstream ENSMUSE00000634779 Chr9:102125718..102125782 ACTGCAGAGTTGGGATGGAC Chr9:102125737..102125756 60.12 55
upstream ENSMUSE00000634778 Chr9:102097104..102097785 GCAGTGTTCCCAGAAACCAT Chr9:102097280..102097299 59.97 50
upstream ENSMUSE00000634777 Chr9:101969201..101969356 CCGAGCTGACTTTGATCCAC Chr9:101969219..101969238 60.8 55

*** Putative Vector Insertion (Chr 9: 101969200 - 102097786) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634776 Chr9:101943342..101943677 GCCCATAGGCTACTGATGGA Chr9:101943424..101943443 60.06 55
downstream ENSMUSE00000634775 Chr9:101912347..101912471 AGGATTATGCCATTGGGTTG Chr9:101912353..101912372 59.65 45
downstream ENSMUSE00000634774 Chr9:101904035..101904197 TCGATACGTGCTGTGTTGGT Chr9:101904117..101904136 60.18 50
downstream ENSMUSE00000634773 Chr9:101899110..101899218 GCTCTCTCAGCTCCGACTTG Chr9:101899170..101899189 60.43 60
downstream ENSMUSE00000634771 Chr9:101898239..101898303 CACTGTACGCAGCCTCTTTG Chr9:101898247..101898266 59.66 55
downstream ENSMUSE00000322723 Chr9:101886412..101886534 GCTCCGATGACCTCTTCAAT Chr9:101886392..101886411 59.24 50
downstream ENSMUSE00000634770 Chr9:101873421..101873668 CTTGTACACCTCGCCGAACT Chr9:101873624..101873643 60.31 55
downstream ENSMUSE00000634769 Chr9:101866262..101866477 CATCCTGGAGGTAGCGAGAG Chr9:101866272..101866291 59.97 60
downstream ENSMUSE00000634768 Chr9:101838399..101838548 ATCGCTGGCTGACGTAAACT Chr9:101838455..101838474 59.9 50
downstream ENSMUSE00000634767 Chr9:101831597..101831790 GTCCAGGGTGTTGACGATCT Chr9:101831628..101831647 59.97 55
downstream ENSMUSE00000634766 Chr9:101829825..101829980 AGTCTGGGATAGAGCGGTCA Chr9:101829921..101829940 59.83 55
downstream ENSMUSE00000634765 Chr9:101824491..101825924 GGGCAACAAGTCCAGTTCAT Chr9:101825643..101825662 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTCCCAGTTGGTCATTTG Chr9:101998787..101998808 59.96 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTCCCAGTTGGTCATTTG Chr9:101998787..101998808 59.96 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032537