Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30317
Trapped Gene
Igf2bp2 (ENSMUSG00000033581)
Vector Insertion
Chr 16: 22121269 - 22161380
Public Clones (sanger) D016G06 (ggtc) IST10745E10 (tigm) IST12126B4 (tigm) IST10908D5 (tigm)
IST12769B8 (tigm) IST12769B8 (tigm) IST10594D3 (tigm) IST15098A3 (tigm)
IST12911A8 (tigm) IST12931H6 (tigm) IST14541E2 (tigm) IST14111H10 (tigm)
IST14099G8 (tigm) IST12923B5 (tigm) IST10208C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000310923 (Chr16:22161319..22161379 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000310923 (Chr16:22161319..22161379 -)
Downstram Exon
ENSMUSE00000702654 (Chr16:22121270..22121322 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40 CATACCTTGGCCACTGTGAA Chr16:22121273..22121292 59.57 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333342 Chr16:22162859..22163107 CTACTCAAGTCCGGCTACGC Chr16:22162915..22162934 60.04 60
upstream ENSMUSE00000310923 Chr16:22161319..22161379 AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40
upstream ENSMUSE00000702656 Chr16:22161319..22161523 AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40
upstream ENSMUSE00000702654 Chr16:22121270..22121322 TTCACAGTGGCCAAGGTATG Chr16:22121295..22121314 59.57 50

*** Putative Vector Insertion (Chr 16: 22121269 - 22161380) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310911 Chr16:22089135..22089183 CCGAATCTGGATTCTTCTGC Chr16:22089140..22089159 59.77 50
downstream ENSMUSE00000560970 Chr16:22087601..22087652 CTTGCTCCACGTTCTCCACT Chr16:22087579..22087598 60.44 55
downstream ENSMUSE00000310892 Chr16:22083997..22084060 GTTGACAACGGCAGTTTCTG Chr16:22084007..22084026 59.34 50
downstream ENSMUSE00000310885 Chr16:22081807..22082058 CTTCATCGGGGATGTAGGAA Chr16:22081966..22081985 59.89 50
downstream ENSMUSE00000310877 Chr16:22080140..22080274 GGGGTAGCATGGATTGTGAC Chr16:22080187..22080206 60.2 55
downstream ENSMUSE00000310871 Chr16:22079557..22079679 GTCTTCCAACGAAGCCATTG Chr16:22079605..22079624 60.64 50
downstream ENSMUSE00000310865 Chr16:22078689..22078824 TGATGGTTCTCTCGGGGTTA Chr16:22078762..22078781 60.45 50
downstream ENSMUSE00000310855 Chr16:22076090..22076218 GCACAGACAGTCCAGTCGAA Chr16:22076127..22076146 60.03 55
downstream ENSMUSE00000644781 Chr16:22070380..22070448 TGGAGAAGTATCCGGAGTGG Chr16:22070405..22070424 60.06 55
downstream ENSMUSE00000310847 Chr16:22068216..22068332 TGGGTTGGGATGAAGAGACT Chr16:22068270..22068289 59.51 50
downstream ENSMUSE00000644775 Chr16:22065166..22065240 TAAACTGGGCTTCAGGAGGA Chr16:22065146..22065165 59.81 50
downstream ENSMUSE00000644773 Chr16:22063655..22063786 GGCCTCCAGCTTCACTTCTT Chr16:22063690..22063709 60.9 55
downstream ENSMUSE00000644771 Chr16:22061933..22062046 AATGCCCGATAATTCTGACG Chr16:22061925..22061944 59.92 45
downstream ENSMUSE00000702655 Chr16:22059533..22060958 GTGGTTCGCATTTGTTCCTT Chr16:22059835..22059854 59.98 45
downstream ENSMUSE00000644770 Chr16:22059149..22060958 CTCACGGCACGTACCCTATT Chr16:22059228..22059247 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGATCCTGCGAGGTGGAG Chr16:22137405..22137425 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGATCCTGCGAGGTGGAG Chr16:22137405..22137425 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033581