Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30325
Trapped Gene
Gmeb2 (ENSMUSG00000038705)
Vector Insertion
Chr 2: 181000519 - 181012827
Public Clones D007A03 (ggtc) D007E03 (ggtc) D007B03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221742 (Chr2:181012654..181012826 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGGCAGTGGTGTAGAGG Chr2:181012697..181012716 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221742 (Chr2:181012654..181012826 -)
Downstram Exon
ENSMUSE00000221731 (Chr2:181000520..181000617 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGGCAGTGGTGTAGAGG Chr2:181012697..181012716 59.7 55 CTAACACGGCTTCCTTGAGC Chr2:181000498..181000517 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000424497 Chr2:181022589..181022671 No primer for this exon
upstream ENSMUSE00000221742 Chr2:181012654..181012826 TGATGGCAGTGGTGTAGAGG Chr2:181012697..181012716 59.7 55
upstream ENSMUSE00000221731 Chr2:181000520..181000617 GCTCAAGGAAGCCGTGTTAG Chr2:181000520..181000539 60.01 55

*** Putative Vector Insertion (Chr 2: 181000519 - 181012827) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221722 Chr2:180999686..180999813 AAGTTCTCCCCCTCTTCAGC Chr2:180999764..180999783 59.82 55
downstream ENSMUSE00000545717 Chr2:180995000..180995103 CTCCTTTGGGCTGATCACAT Chr2:180995052..180995071 60.07 50
downstream ENSMUSE00000221713 Chr2:180993689..180993846 GCTGCGGCAAGTATTAGAGC Chr2:180993755..180993774 60.15 55
downstream ENSMUSE00000221708 Chr2:180990577..180990648 AGTCACCAGGGTCCTCACAG Chr2:180990573..180990592 60.15 60
downstream ENSMUSE00000221761 Chr2:180990200..180990337 CAGTAAGCCCGCATCCTTTA Chr2:180990269..180990288 60.22 50
downstream ENSMUSE00000221754 Chr2:180989847..180989969 AGGTCCCGTGCATACTGTTC Chr2:180989830..180989849 60 55
downstream ENSMUSE00000396312 Chr2:180986156..180989128 AGGAGCCTAGGCACTCAACA Chr2:180987708..180987727 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGAATCCCCTAGGTCTGC Chr2:181003838..181003858 60.04 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAATCCCCTAGGTCTGC Chr2:181003838..181003858 60.04 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038705