Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30359
Trapped Gene
Prr19 (ENSMUSG00000058741)
Vector Insertion
Chr 7: 26088517 - 26088600
Public Clones CMHD-GT_424E7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479903 (Chr7:26087892..26088516 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTAACAGAGGTGCCTTGG Chr7:26088182..26088201 59.88 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479903 (Chr7:26087892..26088516 +)
Downstram Exon
ENSMUSE00000482877 (Chr7:26088601..26089152 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTAACAGAGGTGCCTTGG Chr7:26088182..26088201 59.88 55 TGGGTAACAAGGGTGATGGT Chr7:26088969..26088988 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676650 Chr7:26086378..26086493 GGGGTCCGTTAGGAGAGAAG Chr7:26086471..26086490 60.07 60
upstream ENSMUSE00000479903 Chr7:26087892..26088516 GCTTAACAGAGGTGCCTTGG Chr7:26088182..26088201 59.88 55

*** Putative Vector Insertion (Chr 7: 26088517 - 26088600) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482877 Chr7:26088601..26089152 TGGGTAACAAGGGTGATGGT Chr7:26088969..26088988 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTACCCTTGCCTGGTGAGTC Chr7:26088505..26088525 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACCCTTGCCTGGTGAGTC Chr7:26088505..26088525 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058741