Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30379
Trapped Gene
Nudt16 (ENSMUSG00000032565)
Vector Insertion
Chr 9: 105032841 - 105033622
Public Clones CMHD-GT_435B12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396550 (Chr9:105033623..105033892 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACTACCGCAGCTCACAC Chr9:105033734..105033753 59.65 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396550 (Chr9:105033623..105033892 -)
Downstram Exon
ENSMUSE00000583414 (Chr9:105031668..105032840 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACTACCGCAGCTCACAC Chr9:105033734..105033753 59.65 60 TTTTTAAGCAGGGCAGGCTA Chr9:105032003..105032022 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365338 Chr9:105033973..105034135 CATCGGAAAGTGGAGCTCAG Chr9:105034082..105034101 60.93 55
upstream ENSMUSE00000396550 Chr9:105033623..105033892 CTGACTACCGCAGCTCACAC Chr9:105033734..105033753 59.65 60

*** Putative Vector Insertion (Chr 9: 105032841 - 105033622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583414 Chr9:105031668..105032840 TTTTTAAGCAGGGCAGGCTA Chr9:105032003..105032022 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCAGCTCCAGTCTGTCCT Chr9:105033580..105033600 59.58 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCAGCTCCAGTCTGTCCT Chr9:105033580..105033600 59.58 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032565