Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3039
Trapped Gene
Tmem104 (ENSMUSG00000045980)
Vector Insertion
Chr 11: 115049523 - 115049637
Public Clones XP0012 (sanger) AN0685 (sanger) XP0021 (sanger) RRN197 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000365616 (Chr11:115049524..115049636 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCACAGAGACCGGAGAGC Chr11:115049603..115049622 59.95 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000365616 (Chr11:115049524..115049636 +)
Downstram Exon
ENSMUSE00000709759 (Chr11:115049524..115049636 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCACAGAGACCGGAGAGC Chr11:115049603..115049622 59.95 60 AGAGCTCTCCGGTCTCTGTG Chr11:115049628..115049647 59.73 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670438 Chr11:115048801..115048912 No primer for this exon
upstream ENSMUSE00000441571 Chr11:115048826..115048912 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115049523 - 115049637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365616 Chr11:115049524..115049636 AGAGCTCTCCGGTCTCTGTG Chr11:115049628..115049647 59.73 60
downstream ENSMUSE00000709759 Chr11:115049524..115049636 AGAGCTCTCCGGTCTCTGTG Chr11:115049628..115049647 59.73 60
downstream ENSMUSE00000412914 Chr11:115058550..115058671 GCCCACGATGAGGTTAAACA Chr11:115058588..115058607 60.89 50
downstream ENSMUSE00000364899 Chr11:115062134..115062215 GTGGGTCTCCATCCTCTTCC Chr11:115062215..115062234 60.86 60
downstream ENSMUSE00000386278 Chr11:115062630..115062726 GTCTGAGGCTGTGGACGAGT Chr11:115062668..115062687 60.47 60
downstream ENSMUSE00000404399 Chr11:115063446..115063526 GAAGCCATCTGTCCCATTTC Chr11:115063512..115063531 59.49 50
downstream ENSMUSE00000367406 Chr11:115066376..115066475 ATGGCGAGGTCTCCATACAG Chr11:115066436..115066455 60.1 55
downstream ENSMUSE00000355520 Chr11:115066789..115066849 TGTCGTTGTATCTGGCGTCT Chr11:115066847..115066866 59.32 50
downstream ENSMUSE00000646284 Chr11:115066789..115066897 TGTCGTTGTATCTGGCGTCT Chr11:115066847..115066866 59.32 50
downstream ENSMUSE00000670437 Chr11:115066792..115066897 TGTCGTTGTATCTGGCGTCT Chr11:115066847..115066866 59.32 50
downstream ENSMUSE00000646280 Chr11:115089735..115089828 CCAAGAAGGACGGTGAAGAT Chr11:115089760..115089779 59.14 50
downstream ENSMUSE00000646278 Chr11:115104683..115105444 GCAGAAGATAGCCGTGAAGG Chr11:115104940..115104959 59.98 55
downstream ENSMUSE00000441524 Chr11:115104684..115108337 CCAGGGTGGTCAGCTACAAT Chr11:115106189..115106208 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAACCTCTTGGGCCAGCTA Chr11:115049556..115049576 59.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGCCACTGCATAGAAGTAA Chr11:115049538..115049560 60.95 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045980