Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30398
Trapped Gene
BC051019 (ENSMUSG00000031022)
Vector Insertion
Chr 7: 116855695 - 116856050
Public Clones CMHD-GT_399G11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670973 (Chr7:116855698..116856049 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGGCCTGATGAACTGCTT Chr7:116855832..116855851 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670973 (Chr7:116855698..116856049 -)
Downstram Exon
ENSMUSE00000276795 (Chr7:116855696..116856049 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGGCCTGATGAACTGCTT Chr7:116855832..116855851 59.87 50 AAGCAGTTCATCAGGCCACT Chr7:116855810..116855829 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000417685 Chr7:116867310..116867364 No primer for this exon
upstream ENSMUSE00000670975 Chr7:116866918..116867285 CAGGTATTTCCGTGGCTCAT Chr7:116867030..116867049 59.96 50
upstream ENSMUSE00000589335 Chr7:116866633..116866817 TGTCCTTCACCTGTCCCTTT Chr7:116866677..116866696 59.55 50
upstream ENSMUSE00000720114 Chr7:116866633..116866817 TGTCCTTCACCTGTCCCTTT Chr7:116866677..116866696 59.55 50
upstream ENSMUSE00000589334 Chr7:116864045..116864201 GGAACCGGATGGCTTTTATT Chr7:116864074..116864093 60.15 45
upstream ENSMUSE00000589332 Chr7:116861439..116861673 ATCTGTGCCACACTCACTGC Chr7:116861538..116861557 59.9 55
upstream ENSMUSE00000589331 Chr7:116859360..116860001 AGCTTTTGCCCCTACAAGGT Chr7:116859604..116859623 60.13 50
upstream ENSMUSE00000670973 Chr7:116855698..116856049 AGTGGCCTGATGAACTGCTT Chr7:116855832..116855851 59.87 50
upstream ENSMUSE00000276795 Chr7:116855696..116856049 AGTGGCCTGATGAACTGCTT Chr7:116855832..116855851 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAACGAGTAATCGCCTTGC Chr7:116855987..116856007 60.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAAAAGGGCTTACAACGAG Chr7:116855999..116856020 59.39 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031022