Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI304
Trapped Gene
Zfp42 (ENSMUSG00000051176)
Vector Insertion
Chr 8: 44381891 - 44385981
Public Clones GC0773 (tigem) AZ0394 (sanger) RRU624 (baygenomics) XB238 (baygenomics)
RRZ253 (baygenomics) D034G10 (ggtc) D152A10 (ggtc) P082F06 (ggtc)
P070H02 (ggtc) D152A10 (ggtc) CMHD-GT_285E2-3 (cmhd) PST13315-NR (escells)
PST14520-NR (escells) PST8290-NL (escells) PST23749-NR (escells) PST13482-NR (escells)
PST23739-NR (escells)
Private Clones OST375884 (lexicon) OST319643 (lexicon) OST302006 (lexicon) OST296640 (lexicon)
OST100365 (lexicon) OST39687 (lexicon) OST39650 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482761 (Chr8:44385982..44386059 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAAGTGTTGTCCCCAAAT Chr8:44385997..44386016 60.21 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482761 (Chr8:44385982..44386059 -)
Downstram Exon
ENSMUSE00000480945 (Chr8:44380422..44381890 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAAGTGTTGTCCCCAAAT Chr8:44385997..44386016 60.21 45 CTTTGCGTGGGTTAGGATGT Chr8:44380946..44380965 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510068 Chr8:44392195..44392290 CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55
upstream ENSMUSE00000481791 Chr8:44389830..44389913 GGACACGTGGCAAAAGAAGA Chr8:44389875..44389894 61.22 50
upstream ENSMUSE00000706533 Chr8:44388229..44388333 TCCTGAGCTGTCCTGGAACT Chr8:44388302..44388321 59.99 55
upstream ENSMUSE00000482761 Chr8:44385982..44386059 TCCAAGTGTTGTCCCCAAAT Chr8:44385997..44386016 60.21 45

*** Putative Vector Insertion (Chr 8: 44381891 - 44385981) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480945 Chr8:44380422..44381890 CTTTGCGTGGGTTAGGATGT Chr8:44380946..44380965 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTCTGCTAATCGCCTTGC Chr8:44385918..44385938 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCAAATACCACTGACCAA Chr8:44385983..44386003 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACCGTGCTGTACACCTCAA Chr8:44386083..44386103 59.75 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGCTCCTGCACACAGAAGA Chr8:44383041..44383061 60.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051176