Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30402
Trapped Gene
Ablim2 (ENSMUSG00000029095)
Vector Insertion
Chr 5: 36199830 - 36200474
Public Clones CMHD-GT_398G5-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185464 (Chr5:36199777..36199829 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTTGACCAGGACAGCAG Chr5:36199806..36199825 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185464 (Chr5:36199777..36199829 +)
Downstram Exon
ENSMUSE00000185472 (Chr5:36200475..36200613 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTTGACCAGGACAGCAG Chr5:36199806..36199825 60.59 55 TGGAGAGGTTCCTGGTCAGT Chr5:36200587..36200606 59.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698502 Chr5:36100573..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65
upstream ENSMUSE00000456360 Chr5:36100580..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65
upstream ENSMUSE00000698500 Chr5:36100615..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65
upstream ENSMUSE00000414129 Chr5:36141102..36141245 AGCACTGCGATCCTGTGTAA Chr5:36141146..36141165 59.47 50
upstream ENSMUSE00000185467 Chr5:36145009..36145192 GACTACCAGCGGCTCTATGG Chr5:36145074..36145093 59.86 60
upstream ENSMUSE00000185471 Chr5:36149688..36149803 GACCTTCAACGGGAAGGAGT Chr5:36149715..36149734 60.49 55
upstream ENSMUSE00000185469 Chr5:36151832..36151958 GGGAAACTCCTCAATGCAGA Chr5:36151927..36151946 60.19 50
upstream ENSMUSE00000185474 Chr5:36154775..36154868 CGACGGCTGTGAGAAGTACA Chr5:36154829..36154848 60.05 55
upstream ENSMUSE00000698499 Chr5:36157075..36157312 CTGGTGATGCTGTGTTCTCG Chr5:36157157..36157176 60.46 55
upstream ENSMUSE00000185475 Chr5:36166674..36166761 CCGGAGAGAAGCACTACCAC Chr5:36166675..36166694 59.87 60
upstream ENSMUSE00000185470 Chr5:36170773..36170831 No primer for this exon
upstream ENSMUSE00000653938 Chr5:36174335..36174391 ATGCACAGCTCTGTTTGCAG Chr5:36174335..36174354 60.21 50
upstream ENSMUSE00000185465 Chr5:36175702..36175779 CAGGACTTCTTCGGAGAGCA Chr5:36175707..36175726 60.67 55
upstream ENSMUSE00000185463 Chr5:36179597..36179746 TCGCCCTACATTAGCCACTC Chr5:36179696..36179715 60.24 55
upstream ENSMUSE00000698505 Chr5:36182439..36182471 CTCAGTTGCTCTCACCAACG Chr5:36182443..36182462 59.62 55
upstream ENSMUSE00000185461 Chr5:36183930..36184050 CTCGGACACTACACCCCAAC Chr5:36183999..36184018 60.42 60
upstream ENSMUSE00000653935 Chr5:36185817..36185915 AAGCCCTACATCCGTGTTCA Chr5:36185869..36185888 60.52 50
upstream ENSMUSE00000185476 Chr5:36191453..36191554 CTCCGAGACACTTCCACGTC Chr5:36191531..36191550 60.86 60
upstream ENSMUSE00000185462 Chr5:36192165..36192218 AACCCCCTATCTACAAACAGCA Chr5:36192195..36192216 59.89 45.46
upstream ENSMUSE00000185464 Chr5:36199777..36199829 AGCTTTGACCAGGACAGCAG Chr5:36199806..36199825 60.59 55

*** Putative Vector Insertion (Chr 5: 36199830 - 36200474) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185472 Chr5:36200475..36200613 TGGAGAGGTTCCTGGTCAGT Chr5:36200587..36200606 59.68 55
downstream ENSMUSE00000546596 Chr5:36209354..36209415 GGTCCTGGAAGAGTGTCAGG Chr5:36209393..36209412 59.68 60
downstream ENSMUSE00000546592 Chr5:36215819..36215873 No primer for this exon
downstream ENSMUSE00000698511 Chr5:36215819..36215878 No primer for this exon
downstream ENSMUSE00000653933 Chr5:36217282..36217289 No primer for this exon
downstream ENSMUSE00000698507 Chr5:36217480..36217562 CACGAATTCGGTTTGTTACG Chr5:36217527..36217546 59.08 45
downstream ENSMUSE00000358712 Chr5:36217482..36217562 CACGAATTCGGTTTGTTACG Chr5:36217527..36217546 59.08 45
downstream ENSMUSE00000487216 Chr5:36225955..36227619 CACAGTGTCCACCCATTCTG Chr5:36227362..36227381 60 55
downstream ENSMUSE00000653931 Chr5:36225955..36227115 TTACAAACGGCACTGCTGAG Chr5:36227008..36227027 60.05 50
downstream ENSMUSE00000698494 Chr5:36225955..36226068 GGTCAAACTCCTCGATGCTC Chr5:36226018..36226037 59.81 55
downstream ENSMUSE00000698501 Chr5:36225955..36226798 TCTGCCCCTGACAAGTCTTT Chr5:36226482..36226501 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGGATAATCGCCTTGCAG Chr5:36199875..36199895 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGACAGCAGGAAGGTAA Chr5:36199815..36199835 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029095