Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30406
Trapped Gene
Zbtb3 (ENSMUSG00000071661)
Vector Insertion
Chr 19: 8877022 - 8877463
Public Clones CMHD-GT_398E6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621705 (Chr19:8876986..8877021 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGCGGAGCTCTCCTAGT Chr19:8876986..8877005 59.74 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621705 (Chr19:8876986..8877021 +)
Downstram Exon
ENSMUSE00000550104 (Chr19:8877464..8879342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGCGGAGCTCTCCTAGT Chr19:8876986..8877005 59.74 60 GAGGTCCCCTGACTGTGTGT Chr19:8878900..8878919 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621705 Chr19:8876986..8877021 AGAGGCGGAGCTCTCCTAGT Chr19:8876986..8877005 59.74 60

*** Putative Vector Insertion (Chr 19: 8877022 - 8877463) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000550104 Chr19:8877464..8879342 GAGGTCCCCTGACTGTGTGT Chr19:8878900..8878919 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACGTTGGGAGTCCTTAGCC Chr19:8877052..8877072 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCCTCGTGACTGGGAAA Chr19:8877066..8877086 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071661