Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30423
Trapped Gene
AC102262.9 (ENSMUSG00000078961)
Vector Insertion
Chr 15: 81516833 - 81522537
Public Clones CMHD-GT_383H5-3 (cmhd) IST14528E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680756 (Chr15:81522538..81522736 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGGTGAAGGTTGCAGCTC Chr15:81522651..81522670 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680756 (Chr15:81522538..81522736 -)
Downstram Exon
ENSMUSE00000680755 (Chr15:81516636..81516832 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGGTGAAGGTTGCAGCTC Chr15:81522651..81522670 60 55 CGGAACCAGTTCCTGATGAC Chr15:81516709..81516728 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680759 Chr15:81523417..81523571 TCAGCGGTAATCCTTTCCAC Chr15:81523446..81523465 60.07 50
upstream ENSMUSE00000680756 Chr15:81522538..81522736 GAAGGTGAAGGTTGCAGCTC Chr15:81522651..81522670 60 55

*** Putative Vector Insertion (Chr 15: 81516833 - 81522537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680755 Chr15:81516636..81516832 CGGAACCAGTTCCTGATGAC Chr15:81516709..81516728 60.51 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGACATTGAGGAACAGACA Chr15:81522538..81522558 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGACATTGAGGAACAGACA Chr15:81522538..81522558 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTTCCTCAGGTGGCTCACT Chr15:81519725..81519745 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGACTGGGTCTGCAGAAGG Chr15:81519728..81519748 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078961