Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30424
Trapped Gene
Socs7 (ENSMUSG00000038485)
Vector Insertion
Chr 11: 97251031 - 97254702
Public Clones CMHD-GT_384E10-3 (cmhd) CMHD-GT_532D3-3 (cmhd) IST14095F9 (tigm) IST14827G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286660 (Chr11:97250880..97251030 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAAAGGAAGCGCAGCTCAT Chr11:97250944..97250963 59.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286660 (Chr11:97250880..97251030 +)
Downstram Exon
ENSMUSE00000383143 (Chr11:97254703..97259856 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAAAGGAAGCGCAGCTCAT Chr11:97250944..97250963 59.75 50 AAGACATGGGTCGGTACAGC Chr11:97259811..97259830 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379250 Chr11:97223865..97224737 GAAGGGCTCCTTCAAAATCC Chr11:97224567..97224586 60.02 50
upstream ENSMUSE00000286717 Chr11:97234380..97234444 CCCAGGTTGACAAGAACTCAA Chr11:97234384..97234404 60.13 47.62
upstream ENSMUSE00000286708 Chr11:97237751..97237855 CAGTATCGCTTGTGGACGTG Chr11:97237757..97237776 60.32 55
upstream ENSMUSE00000286697 Chr11:97238311..97238412 GACGCTGCCTACATCTGTCC Chr11:97238324..97238343 60.83 60
upstream ENSMUSE00000286688 Chr11:97239250..97239380 CCATCAGAGCGTCAGAATCC Chr11:97239271..97239290 60.77 55
upstream ENSMUSE00000286682 Chr11:97239857..97240025 GAGCCTCAGCTTTCGATCAC Chr11:97239967..97239986 60.1 55
upstream ENSMUSE00000286675 Chr11:97244214..97244342 TATGGTGCCATCCCAAGTTT Chr11:97244226..97244245 60.19 45
upstream ENSMUSE00000286667 Chr11:97250426..97250561 ATATTCCGGATCTGCCACTG Chr11:97250537..97250556 59.92 50
upstream ENSMUSE00000286660 Chr11:97250880..97251030 CTAAAGGAAGCGCAGCTCAT Chr11:97250944..97250963 59.75 50

*** Putative Vector Insertion (Chr 11: 97251031 - 97254702) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383143 Chr11:97254703..97259856 AAGACATGGGTCGGTACAGC Chr11:97259811..97259830 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCACGTAGCAGCAAGGAC Chr11:97250992..97251012 61.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCACGTAGCAGCAAGGAC Chr11:97250992..97251012 61.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038485