Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3043
Trapped Gene
6720456B07Rik (ENSMUSG00000033940)
Vector Insertion
Chr 6: 113554891 - 113565769
Public Clones (sanger) (sanger) DC0002 (sanger) RHA318 (baygenomics) D037F05 (ggtc)
CMHD-GT_506C11-3 (cmhd)
Private Clones OST446780 (lexicon) OST421246 (lexicon) OST404445 (lexicon) OST390737 (lexicon)
OST375966 (lexicon) OST367894 (lexicon) OST299181 (lexicon) OST267536 (lexicon)
OST50182 (lexicon) OST45446 (lexicon) OST34799 (lexicon) OST34617 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222791 (Chr6:113554752..113554890 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAACCGGGAGTACATTGAG Chr6:113554822..113554841 60.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222791 (Chr6:113554752..113554890 +)
Downstram Exon
ENSMUSE00000222782 (Chr6:113565770..113565852 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAACCGGGAGTACATTGAG Chr6:113554822..113554841 60.51 55 GTGTTGCGAGTCTTGAACGA Chr6:113565802..113565821 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000222791 Chr6:113554752..113554890 CGAACCGGGAGTACATTGAG Chr6:113554822..113554841 60.51 55

*** Putative Vector Insertion (Chr 6: 113554891 - 113565769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222782 Chr6:113565770..113565852 GTGTTGCGAGTCTTGAACGA Chr6:113565802..113565821 60.03 50
downstream ENSMUSE00000373930 Chr6:113566059..113566688 GGCGCACTTCTAGGTCAGAG Chr6:113566097..113566116 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAAAACATCCCCTCCAG Chr6:113554909..113554929 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr6:113554938..113554958 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033940