Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30436
Trapped Gene
Usp4 (ENSMUSG00000032612)
Vector Insertion
Chr 9: 108287288 - 108290607
Public Clones CMHD-GT_364G12-3 (cmhd) CMHD-GT_364H12-3 (cmhd) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221556 (Chr9:108287138..108287287 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACCTCAAGCGTTTCTCC Chr9:108287215..108287234 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221556 (Chr9:108287138..108287287 +)
Downstram Exon
ENSMUSE00000221547 (Chr9:108290608..108290711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACCTCAAGCGTTTCTCC Chr9:108287215..108287234 60.38 50 CCCATGGCTCCATAGTGATT Chr9:108290703..108290722 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000244407 Chr9:108250199..108250349 ATGTGGAGACCCAGAAGACG Chr9:108250283..108250302 60.11 55
upstream ENSMUSE00000244380 Chr9:108253241..108253368 CTTATTGACAGCCGGTGGTT Chr9:108253245..108253264 59.99 50
upstream ENSMUSE00000244351 Chr9:108258742..108258872 AGCCGAAGCCTGGAATAAAT Chr9:108258803..108258822 60.06 45
upstream ENSMUSE00000529787 Chr9:108262426..108262552 GACCCCACCAATGTGCTAAG Chr9:108262504..108262523 60.38 55
upstream ENSMUSE00000244299 Chr9:108264892..108265037 AACACGGCTTTGGAACAAAT Chr9:108264944..108264963 59.48 40
upstream ENSMUSE00000221570 Chr9:108265168..108265229 TTGAGCCCCAAAATGAAGAT Chr9:108265178..108265197 59.51 40
upstream ENSMUSE00000244248 Chr9:108268161..108268301 CTTCAAAACCATCCGCAAGT Chr9:108268196..108268215 60.11 45
upstream ENSMUSE00000244226 Chr9:108269092..108269209 CTGGGGAACACTTGCTTCAT Chr9:108269174..108269193 60.11 50
upstream ENSMUSE00000244203 Chr9:108270150..108270323 TGAAAGGGGAGATTGCAGAG Chr9:108270235..108270254 60.33 50
upstream ENSMUSE00000221563 Chr9:108273232..108273390 GACCTGAACCGCGTAAAGAA Chr9:108273325..108273344 60.25 50
upstream ENSMUSE00000221567 Chr9:108274893..108275117 CTTTGGTTTGCCCAGAATGT Chr9:108274978..108274997 59.97 45
upstream ENSMUSE00000221576 Chr9:108275938..108276021 TACCGTGTGACTGTGCCATT Chr9:108275938..108275957 60.03 50
upstream ENSMUSE00000221551 Chr9:108276555..108276649 AATCACCGCTTCCACAAAAT Chr9:108276576..108276595 59.43 40
upstream ENSMUSE00000221545 Chr9:108280767..108280958 CCAGGCTGTTTGTGATCGTA Chr9:108280935..108280954 59.72 50
upstream ENSMUSE00000221573 Chr9:108281596..108281684 CCTGCAATGGCTCTAGGAGT Chr9:108281655..108281674 59.45 55
upstream ENSMUSE00000221552 Chr9:108283659..108283883 GGGAGATGACCATAGCGAGA Chr9:108283741..108283760 60.18 55
upstream ENSMUSE00000221562 Chr9:108286416..108286486 TGAGACCCGAAGCCTTTACT Chr9:108286447..108286466 58.93 50
upstream ENSMUSE00000221565 Chr9:108286728..108286846 ACAGCCGCAGAAGAAGAAGA Chr9:108286754..108286773 60.28 50
upstream ENSMUSE00000221556 Chr9:108287138..108287287 TTCACCTCAAGCGTTTCTCC Chr9:108287215..108287234 60.38 50

*** Putative Vector Insertion (Chr 9: 108287288 - 108290607) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221547 Chr9:108290608..108290711 CCCATGGCTCCATAGTGATT Chr9:108290703..108290722 59.77 50
downstream ENSMUSE00000221569 Chr9:108293311..108293399 CCATTTCCCGTTCAGTCTGT Chr9:108293351..108293370 59.97 50
downstream ENSMUSE00000221572 Chr9:108294010..108294857 CCGACGCTGATAGAACAACA Chr9:108294048..108294067 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGCTGGTAATCGCCTTG Chr9:108287330..108287350 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTGGAGTTCCCAGTCAG Chr9:108287269..108287289 60.56 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032612