Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30443
Trapped Gene
Rpap1 (ENSMUSG00000034032)
Vector Insertion
Chr 2: 119608968 - 119609469
Public Clones CMHD-GT_364A8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710360 (Chr2:119609470..119609706 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGTGATGCTCCTCCAGAC Chr2:119609513..119609532 60.08 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710360 (Chr2:119609470..119609706 -)
Downstram Exon
ENSMUSE00000396666 (Chr2:119608819..119608967 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGTGATGCTCCTCCAGAC Chr2:119609513..119609532 60.08 55 GCTCGGTCTTGCTCTTTTTG Chr2:119608887..119608906 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685413 Chr2:119613171..119613240 GGAGTAGGTTGCTGTTTGCAG Chr2:119613193..119613213 59.93 52.38
upstream ENSMUSE00000430584 Chr2:119613151..119613273 CTCAGGTGGAGAACCCAGAA Chr2:119613156..119613175 60.23 55
upstream ENSMUSE00000642128 Chr2:119613151..119613233 CTCAGGTGGAGAACCCAGAA Chr2:119613156..119613175 60.23 55
upstream ENSMUSE00000642127 Chr2:119612957..119613033 GCAATCTCTGGATTGGTCGT Chr2:119612976..119612995 60.08 50
upstream ENSMUSE00000685412 Chr2:119612923..119613033 GGCTGCGATGTAAGAGGCTA Chr2:119612946..119612965 60.51 55
upstream ENSMUSE00000509941 Chr2:119609470..119609706 ATGGTGATGCTCCTCCAGAC Chr2:119609513..119609532 60.08 55
upstream ENSMUSE00000710360 Chr2:119609470..119609706 ATGGTGATGCTCCTCCAGAC Chr2:119609513..119609532 60.08 55

*** Putative Vector Insertion (Chr 2: 119608968 - 119609469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000396666 Chr2:119608819..119608967 GCTCGGTCTTGCTCTTTTTG Chr2:119608887..119608906 60.13 50
downstream ENSMUSE00000353139 Chr2:119608382..119608471 TCTCCTGAGAGCGATGGAAC Chr2:119608365..119608384 60.5 55
downstream ENSMUSE00000303055 Chr2:119605792..119605912 ACACCCTTCTTGCTGCAATC Chr2:119605827..119605846 60.26 50
downstream ENSMUSE00000356250 Chr2:119603853..119604074 CCTGAAGGAGGGTGTCTCAC Chr2:119604021..119604040 59.68 60
downstream ENSMUSE00000430565 Chr2:119602402..119602629 TTGTTCCTGGACCTGGCTAT Chr2:119602558..119602577 59.55 50
downstream ENSMUSE00000430563 Chr2:119601032..119601147 ATGTGGAGCCAGTCTTTGCT Chr2:119601083..119601102 59.87 50
downstream ENSMUSE00000430561 Chr2:119600689..119600787 GTGGGAAGATCCACATCAGG Chr2:119600704..119600723 60.33 55
downstream ENSMUSE00000430560 Chr2:119599854..119599955 CTACGGGTCAGGTGGAACAG Chr2:119599890..119599909 60.56 60
downstream ENSMUSE00000430556 Chr2:119599527..119599694 ATCTCCAGGAGCCACTAGCA Chr2:119599508..119599527 59.97 55
downstream ENSMUSE00000430553 Chr2:119599126..119599308 GAACACCGAAGCTCCATGAT Chr2:119599239..119599258 60.08 50
downstream ENSMUSE00000430381 Chr2:119598874..119599008 CAGGTCACCTCCAGCACATA Chr2:119598931..119598950 59.7 55
downstream ENSMUSE00000430375 Chr2:119598224..119598394 GACCAACTGGTAGGCAGGAA Chr2:119598311..119598330 60.11 55
downstream ENSMUSE00000430369 Chr2:119597475..119597632 TCAGCTATGAATCGGCACAG Chr2:119597564..119597583 59.97 50
downstream ENSMUSE00000430365 Chr2:119596932..119597090 TGAGCTGGGTAAGCAGTGTG Chr2:119596947..119596966 60.05 55
downstream ENSMUSE00000430361 Chr2:119596626..119596827 TGTGTCCAGGTGACTGAGGA Chr2:119596752..119596771 60.29 55
downstream ENSMUSE00000430356 Chr2:119596056..119596165 CAGCAAGGACTCATCCAACA Chr2:119596081..119596100 59.83 50
downstream ENSMUSE00000430349 Chr2:119595623..119595818 AGAGGAGGGCAGTGAGGAAC Chr2:119595648..119595667 60.79 60
downstream ENSMUSE00000430347 Chr2:119595316..119595468 GCGAAGGAAAGCACCAGATA Chr2:119595304..119595323 60.35 50
downstream ENSMUSE00000430339 Chr2:119594986..119595128 AGCTCCTGGGCAAGGTATTC Chr2:119595000..119595019 60.6 55
downstream ENSMUSE00000385932 Chr2:119593228..119593984 CTCGAAACAGCTCGCTATCC Chr2:119593487..119593506 60.12 55
downstream ENSMUSE00000303614 Chr2:119590475..119590651 CCGGAAGTAGAGCTGAAGGA Chr2:119590558..119590577 59.57 55
downstream ENSMUSE00000303608 Chr2:119590280..119590339 CCTTCGGGCAGTCTTTACCT Chr2:119590294..119590313 60.62 55
downstream ENSMUSE00000402214 Chr2:119589700..119590180 GCTCACAGGAAGGCAAGTCT Chr2:119589911..119589930 59.6 55
downstream ENSMUSE00000685408 Chr2:119589696..119590180 GCTCACAGGAAGGCAAGTCT Chr2:119589911..119589930 59.6 55
downstream ENSMUSE00000685411 Chr2:119589040..119590180 TCTGTGGGCAGTGTCTGAAG Chr2:119590040..119590059 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGACAGTGAGTGCTTTCG Chr2:119609455..119609475 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACAGTGAGTGCTTTCG Chr2:119609455..119609475 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034032