Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30459
Trapped Gene
Nlgn3 (ENSMUSG00000031302)
Vector Insertion
Chr X: 98498471 - 98502413
Public Clones CMHD-GT_330E11-3 (cmhd) IST13433B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000549135 (ChrX:98498411..98498470 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAAAGCCCAACAAGAAAAT ChrX:98498437..98498456 59.2 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000549135 (ChrX:98498411..98498470 +)
Downstram Exon
ENSMUSE00000287940 (ChrX:98502414..98502473 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAAAGCCCAACAAGAAAAT ChrX:98498437..98498456 59.2 40 AAGTCCTCGCCCTGTTTCTT ChrX:98502447..98502466 60.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709907 ChrX:98494507..98494635 No primer for this exon
upstream ENSMUSE00000444948 ChrX:98494549..98494635 No primer for this exon
upstream ENSMUSE00000373778 ChrX:98497124..98497770 CTTGGATATCGTCGCCACTT ChrX:98497691..98497710 60.1 50
upstream ENSMUSE00000709974 ChrX:98497627..98497770 CTTGGATATCGTCGCCACTT ChrX:98497691..98497710 60.1 50
upstream ENSMUSE00000549135 ChrX:98498411..98498470 CGAAAGCCCAACAAGAAAAT ChrX:98498437..98498456 59.2 40

*** Putative Vector Insertion (Chr X: 98498471 - 98502413) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000287940 ChrX:98502414..98502473 AAGTCCTCGCCCTGTTTCTT ChrX:98502447..98502466 60.25 50
downstream ENSMUSE00000208094 ChrX:98504096..98504245 GACCCGATAGTTGAGGGTGA ChrX:98504238..98504257 59.93 55
downstream ENSMUSE00000622986 ChrX:98510471..98510656 GCCTGGATTTGATCAAGGAG ChrX:98510537..98510556 59.63 50
downstream ENSMUSE00000208089 ChrX:98513268..98514057 CTACCAGCTCCTTGGCACTC ChrX:98513441..98513460 60.01 60
downstream ENSMUSE00000444921 ChrX:98514758..98516687 TGCAGTTGGTAGAGGTGCAG ChrX:98515962..98515981 60.05 55
downstream ENSMUSE00000718745 ChrX:98514758..98521302 TCCAATGAGTGCAAGACAGC ChrX:98520582..98520601 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAAAGCCCAACAAGAAAAT ChrX:98498437..98498458 62.47 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAAAGCCCAACAAGAAAAT ChrX:98498437..98498458 62.47 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031302