Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30461
Trapped Gene
Chfr (ENSMUSG00000014668)
Vector Insertion
Chr 5: 110569473 - 110572569
Public Clones CMHD-GT_330E9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334959 (Chr5:110569373..110569472 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334959 (Chr5:110569373..110569472 +)
Downstram Exon
ENSMUSE00000189532 (Chr5:110572570..110572679 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348208 Chr5:110564879..110564953 No primer for this exon
upstream ENSMUSE00000391403 Chr5:110565070..110565213 No primer for this exon
upstream ENSMUSE00000334959 Chr5:110569373..110569472 No primer for this exon

*** Putative Vector Insertion (Chr 5: 110569473 - 110572569) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189532 Chr5:110572570..110572679 No primer for this exon
downstream ENSMUSE00000189545 Chr5:110573610..110573669 No primer for this exon
downstream ENSMUSE00000299409 Chr5:110573791..110574006 No primer for this exon
downstream ENSMUSE00000189542 Chr5:110575489..110575653 No primer for this exon
downstream ENSMUSE00000299391 Chr5:110580546..110580705 No primer for this exon
downstream ENSMUSE00000299382 Chr5:110581355..110581509 No primer for this exon
downstream ENSMUSE00000189543 Chr5:110582137..110582299 No primer for this exon
downstream ENSMUSE00000189544 Chr5:110583856..110584001 No primer for this exon
downstream ENSMUSE00000358074 Chr5:110587818..110587937 No primer for this exon
downstream ENSMUSE00000651294 Chr5:110587821..110587937 No primer for this exon
downstream ENSMUSE00000189536 Chr5:110589177..110589260 No primer for this exon
downstream ENSMUSE00000367415 Chr5:110591730..110591800 No primer for this exon
downstream ENSMUSE00000189534 Chr5:110593025..110593112 No primer for this exon
downstream ENSMUSE00000189538 Chr5:110597143..110597250 No primer for this exon
downstream ENSMUSE00000404714 Chr5:110598161..110598233 No primer for this exon
downstream ENSMUSE00000384927 Chr5:110599881..110600991 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGTGAGGTGACACTGGA Chr5:110572445..110572465 60.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATTTTGAGTGGGCGTGA Chr5:110572509..110572529 58.62 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014668