Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30472
Trapped Gene
Deb1 (ENSMUSG00000032526)
Vector Insertion
Chr 9: 121619834 - 121621682
Public Clones CMHD-GT_296C2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505003 (Chr9:121619757..121619833 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCCGCTGTATCGTGGAGT Chr9:121619780..121619799 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505003 (Chr9:121619757..121619833 +)
Downstram Exon
ENSMUSE00000528130 (Chr9:121621683..121622039 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCCGCTGTATCGTGGAGT Chr9:121619780..121619799 60.1 55 CAGGTCCTCAGGTTCTACCG Chr9:121621958..121621977 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000430469 Chr9:121619516..121619589 CTTCGCTCCTGACTGGCTAC Chr9:121619532..121619551 60.16 60
upstream ENSMUSE00000519605 Chr9:121619562..121619833 GATCCGCTGTATCGTGGAGT Chr9:121619780..121619799 60.1 55
upstream ENSMUSE00000505003 Chr9:121619757..121619833 GATCCGCTGTATCGTGGAGT Chr9:121619780..121619799 60.1 55

*** Putative Vector Insertion (Chr 9: 121619834 - 121621682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000528130 Chr9:121621683..121622039 CAGGTCCTCAGGTTCTACCG Chr9:121621958..121621977 59.72 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGAGTGCGTCCAGTAAGTG Chr9:121619822..121619842 58.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGAGTGCGTCCAGTAAGTG Chr9:121619822..121619842 58.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032526