Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30483
Trapped Gene
Cldn14 (ENSMUSG00000047109)
Vector Insertion
Chr 16: 93920283 - 93942512
Public Clones CMHD-GT_297H2-3 (cmhd) IST10751B6 (tigm) IST13661B10 (tigm) IST14943E6 (tigm)
IST10751B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345029 (Chr16:93942513..93942650 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGACTGTTGAAGCCGCAGT Chr16:93942589..93942608 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345029 (Chr16:93942513..93942650 -)
Downstram Exon
ENSMUSE00000381792 (Chr16:93919278..93920282 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGACTGTTGAAGCCGCAGT Chr16:93942589..93942608 60.06 50 GGATACGGCAGTCAGGATGT Chr16:93920045..93920064 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358636 Chr16:94008770..94009082 TTGCCCTGTGGTTCATACAA Chr16:94008891..94008910 59.96 45
upstream ENSMUSE00000345029 Chr16:93942513..93942650 AAGACTGTTGAAGCCGCAGT Chr16:93942589..93942608 60.06 50

*** Putative Vector Insertion (Chr 16: 93920283 - 93942512) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381792 Chr16:93919278..93920282 GGATACGGCAGTCAGGATGT Chr16:93920045..93920064 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGGGTAGCAAGCTTTTCA Chr16:93924492..93924512 60.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGGGTAGCAAGCTTTTCA Chr16:93924492..93924512 60.25 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAACACCTTCTAATCGCCTTG Chr16:93924589..93924610 59.76 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCCGTGACTGGGAAAACC Chr16:93924584..93924604 61.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047109