Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30487
Trapped Gene
Alad (ENSMUSG00000028393)
Vector Insertion
Chr 4: 62175295 - 62180893
Public Clones Ayu21-T323 (egtc) IST14825B9 (tigm) IST14204C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000451631 (Chr4:62180894..62180927 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000451631 (Chr4:62180894..62180927 -)
Downstram Exon
ENSMUSE00000711779 (Chr4:62175108..62175294 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGATGAGGTTGGAGGCACTG Chr4:62175102..62175121 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451631 Chr4:62180894..62180927 No primer for this exon
upstream ENSMUSE00000673126 Chr4:62180829..62180928 No primer for this exon

*** Putative Vector Insertion (Chr 4: 62175295 - 62180893) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407974 Chr4:62175108..62175294 AGATGAGGTTGGAGGCACTG Chr4:62175102..62175121 60.26 55
downstream ENSMUSE00000711779 Chr4:62175108..62175294 AGATGAGGTTGGAGGCACTG Chr4:62175102..62175121 60.26 55
downstream ENSMUSE00000178700 Chr4:62174566..62174616 CGATAGGCTGGACATCATCA Chr4:62174566..62174585 59.63 50
downstream ENSMUSE00000178694 Chr4:62173905..62174001 GACGCCAAAGATCAGGACAC Chr4:62173901..62173920 60.67 55
downstream ENSMUSE00000320766 Chr4:62172921..62173056 AAGGGAAGGTCTTCCTCAGC Chr4:62172956..62172975 59.82 55
downstream ENSMUSE00000320759 Chr4:62172736..62172819 CCTCTGCTAGGAATGCTCCA Chr4:62172762..62172781 60.49 55
downstream ENSMUSE00000320752 Chr4:62172558..62172646 AACTCGTCCGTCCATCATGT Chr4:62172581..62172600 60.4 50
downstream ENSMUSE00000178702 Chr4:62171902..62171957 CGGAAAGGACCGTAGAAACA Chr4:62171880..62171899 60.1 50
downstream ENSMUSE00000178705 Chr4:62171728..62171815 GCTGATAACAGCGTCGGTCT Chr4:62171744..62171763 60.43 55
downstream ENSMUSE00000178695 Chr4:62171549..62171635 TTCACCATGAGCATGTCAGC Chr4:62171573..62171592 60.85 50
downstream ENSMUSE00000178703 Chr4:62171139..62171268 CATGGCAAACTCTCCAGACA Chr4:62171196..62171215 59.83 50
downstream ENSMUSE00000673124 Chr4:62170203..62170344 CGGTGCAAAGTAGGTGATGA Chr4:62170291..62170310 59.72 50
downstream ENSMUSE00000320717 Chr4:62170202..62170344 CGGTGCAAAGTAGGTGATGA Chr4:62170291..62170310 59.72 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCTCTTGTGTCCTGTGA Chr4:62180863..62180883 58.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000028393