Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30506
Trapped Gene
A530082C11Rik (ENSMUSG00000042202)
Vector Insertion
Chr 4: 154997450 - 155084560
Public Clones (sanger) PST21327-NR (escells) IST10771A9 (tigm) IST10990E3 (tigm)
IST14224B5 (tigm) IST15028H11 (tigm) IST12669H4 (tigm) IST11226E6 (tigm)
IST11554H11 (tigm) IST12135C1 (tigm) IST14759E11 (tigm) IST14250H10 (tigm)
IST13352G11 (tigm) IST13805G5 (tigm) IST11508G12 (tigm) IST10963B4 (tigm)
IST15089E6 (tigm) IST14312C11 (tigm) IST13197D11 (tigm) IST11409G1 (tigm)
IST13945F11 (tigm) IST10230D9 (tigm) IST10673A11 (tigm) IST14857D4 (tigm)
IST14056H7 (tigm) IST14733C8 (tigm) IST14027E3 (tigm) IST12716E1 (tigm)
IST10963B4 (tigm) IST13061C6 (tigm) IST12468B6 (tigm) IST13754G10 (tigm)
IST14239A8 (tigm) IST13401C6 (tigm) IST14955A8 (tigm) IST12380A4 (tigm)
IST12088H12 (tigm) IST10937H1 (tigm) IST12749G9 (tigm) IST11571F5 (tigm)
IST14204D4 (tigm) IST13424C12 (tigm) IST14951G5 (tigm) IST11564F12 (tigm)
IST12744E5 (tigm) IST11938C1 (tigm) IST12738F8 (tigm) IST11976H11 (tigm)
IST14569G2 (tigm) IST15026E10 (tigm) IST13510E6 (tigm) IST12648D1 (tigm)
IST12812D7 (tigm) IST10795H12 (tigm) IST12380A4 (tigm) IST10029G10 (tigm)
IST11653H12 (tigm) IST14444G7 (tigm) IST10550D3 (tigm) IST14472H9 (tigm)
IST13352G11 (tigm) IST10771A9 (tigm) IST11626G3 (tigm) IST11227B7HMF1 (tigm)
IST14955A8 (tigm) IST13197D11 (tigm) IST14569F6 (tigm) IST15026E10 (tigm)
IST13754G10 (tigm) IST14635A7 (tigm) IST10699D11 (tigm) IST13055F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666864 (Chr4:154992621..154997449 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666864 (Chr4:154992621..154997449 +)
Downstram Exon
ENSMUSE00000705428 (Chr4:155084561..155084606 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55 TATTTGTTCTTGCTGGGCAGT Chr4:155084599..155084619 59.76 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666868 Chr4:154975525..154975847 GTTCCGGAATGTACCACAGG Chr4:154975681..154975700 60.23 55
upstream ENSMUSE00000629991 Chr4:154975720..154975911 No primer for this exon
upstream ENSMUSE00000720362 Chr4:154976053..154976271 CTTGACTCTGGACCGCTCTG Chr4:154976063..154976082 61.14 60
upstream ENSMUSE00000385931 Chr4:154983948..154984428 TCTGGGTGTGTGGAGTTCAA Chr4:154984307..154984326 60.13 50
upstream ENSMUSE00000714465 Chr4:154983948..154984428 TCTGGGTGTGTGGAGTTCAA Chr4:154984307..154984326 60.13 50
upstream ENSMUSE00000364267 Chr4:154984610..154984745 TGTGCAGATGCTGTCAACAA Chr4:154984614..154984633 60.03 45
upstream ENSMUSE00000351054 Chr4:154985725..154985852 AGCCTCAAGAATGTGGCAGT Chr4:154985753..154985772 59.87 50
upstream ENSMUSE00000354819 Chr4:154986726..154986846 ATGGGAGGACTAGCGTTGTG Chr4:154986758..154986777 60.13 55
upstream ENSMUSE00000385437 Chr4:154989678..154989731 AGCTTCTCAGTGGGGACAAA Chr4:154989701..154989720 59.84 50
upstream ENSMUSE00000360714 Chr4:154990292..154990364 CCAGCATGGACCTTCTTCAT Chr4:154990344..154990363 60.07 50
upstream ENSMUSE00000387278 Chr4:154991724..154991869 AGCTACAGCCAGGACATCGT Chr4:154991760..154991779 59.9 55
upstream ENSMUSE00000368567 Chr4:154992621..154994199 TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55
upstream ENSMUSE00000666862 Chr4:154992621..154995132 TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55
upstream ENSMUSE00000666864 Chr4:154992621..154997449 TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55
upstream ENSMUSE00000705429 Chr4:154992621..154995137 TGTGCTGGACATCAGCTAGG Chr4:154994067..154994086 60.01 55
upstream ENSMUSE00000717805 Chr4:154992621..154993428 ACCCAGAGTAGCAGGCAGAA Chr4:154993243..154993262 60.01 55
upstream ENSMUSE00000666861 Chr4:154995626..154996015 ATTGAATTCGGGTCGTCTTG Chr4:154995774..154995793 59.93 45
upstream ENSMUSE00000666860 Chr4:154996461..154997447 TCAATGTTGGCACTTTGGAA Chr4:154997214..154997233 60.09 40

*** Putative Vector Insertion (Chr 4: 154997450 - 155084560) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000705428 Chr4:155084561..155084606 TATTTGTTCTTGCTGGGCAGT Chr4:155084599..155084619 59.76 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATGGTAGGGTTGTAAATGT Chr4:155051402..155051424 59.87 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCATGGTAGGGTTGTAAATGT Chr4:155051402..155051424 59.87 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042202