Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30509
Trapped Gene
Lhfp (ENSMUSG00000048332)
Vector Insertion
Chr 3: 52847614 - 53035651
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) IST13504F4 (tigm) IST14661C5 (tigm) IST12680A9 (tigm) IST10008F8 (tigm)
IST14604B11 (tigm) IST10282G9 (tigm) IST10960D4 (tigm) IST14180B2 (tigm)
IST12577A9 (tigm) IST13496D9 (tigm) IST12947A11 (tigm) IST13928F5 (tigm)
IST12494E6 (tigm) IST14993G5 (tigm) IST14508C5 (tigm) IST12680A9 (tigm)
IST11044H4 (tigm) IST14410F9 (tigm) IST14768H9 (tigm) IST12618D8 (tigm)
IST12313G10 (tigm) IST14294G4 (tigm) IST11308D5 (tigm) IST11142D6 (tigm)
IST14919F2 (tigm) IST10390E5 (tigm) IST11190D9BBF1 (tigm) IST10872H1 (tigm)
IST11698A1 (tigm) IST10746E3 (tigm) IST13382F11 (tigm) IST10830D7 (tigm)
IST14742F6 (tigm) IST14769E9 (tigm) IST13682G7 (tigm) IST10997E3 (tigm)
IST11044H4 (tigm) IST10832C7 (tigm) IST14225F2 (tigm) IST12101E8 (tigm)
IST11467C1 (tigm) IST11467C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376542 (Chr3:52847041..52847613 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGAGCGGTGGACTACCTG Chr3:52847129..52847148 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376542 (Chr3:52847041..52847613 +)
Downstram Exon
ENSMUSE00000333536 (Chr3:53035652..53035750 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGAGCGGTGGACTACCTG Chr3:52847129..52847148 59.87 60 CAAACTGGCCAGAGATGTAGC Chr3:53035746..53035766 59.89 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639303 Chr3:52845469..52845696 AGTGGCAAAGGCAAGAAAGA Chr3:52845581..52845600 59.99 45
upstream ENSMUSE00000376542 Chr3:52847041..52847613 GAAGAGCGGTGGACTACCTG Chr3:52847129..52847148 59.87 60

*** Putative Vector Insertion (Chr 3: 52847614 - 53035651) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333536 Chr3:53035652..53035750 CAAACTGGCCAGAGATGTAGC Chr3:53035746..53035766 59.89 52.38
downstream ENSMUSE00000591972 Chr3:53064413..53065597 AGCCATCCATGTACACAGCA Chr3:53064495..53064514 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAAGTTTGTTCCGCTCCTC Chr3:52904623..52904643 59.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGTTTGTTCCGCTCCTC Chr3:52904623..52904643 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048332