Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30510
Trapped Gene
Fam167a (ENSMUSG00000035095)
Vector Insertion
Chr 14: 64071477 - 64081213
Public Clones (ggtc) IST11040D11BBF1 (tigm) IST12676C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557721 (Chr14:64071396..64071476 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGCCTGGCTCAGAAAGGAA Chr14:64071454..64071473 60.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557721 (Chr14:64071396..64071476 +)
Downstram Exon
ENSMUSE00000706483 (Chr14:64081214..64081477 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGCCTGGCTCAGAAAGGAA Chr14:64071454..64071473 60.09 50 CAAAAGAGGTCGGACAGCTC Chr14:64081380..64081399 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000721157 Chr14:64055231..64055469 GCAAAAGAACGTCCCTTCAA Chr14:64055310..64055329 60.23 45
upstream ENSMUSE00000509266 Chr14:64055292..64055469 GCAAAAGAACGTCCCTTCAA Chr14:64055310..64055329 60.23 45
upstream ENSMUSE00000508355 Chr14:64060750..64060777 No primer for this exon
upstream ENSMUSE00000709278 Chr14:64060750..64060850 AAGCCTTTCTGGGTGAAGGT Chr14:64060815..64060834 60.11 50
upstream ENSMUSE00000711892 Chr14:64070708..64071476 CCCAGATCCAAGTGGAAGAA Chr14:64071103..64071122 60.04 50
upstream ENSMUSE00000557722 Chr14:64070791..64071476 CCCAGATCCAAGTGGAAGAA Chr14:64071103..64071122 60.04 50
upstream ENSMUSE00000415022 Chr14:64071266..64071394 CTCTAAAGGAGCCCCGAGAC Chr14:64071346..64071365 60.34 60
upstream ENSMUSE00000557721 Chr14:64071396..64071476 TAGCCTGGCTCAGAAAGGAA Chr14:64071454..64071473 60.09 50

*** Putative Vector Insertion (Chr 14: 64071477 - 64081213) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687034 Chr14:64081214..64084334 CAAAAGAGGTCGGACAGCTC Chr14:64081380..64081399 59.99 55
downstream ENSMUSE00000706483 Chr14:64081214..64081477 CAAAAGAGGTCGGACAGCTC Chr14:64081380..64081399 59.99 55
downstream ENSMUSE00000716954 Chr14:64081214..64084335 CAAAAGAGGTCGGACAGCTC Chr14:64081380..64081399 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGGCTCAGAAAGGAACTG Chr14:64071458..64071478 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGGCTCAGAAAGGAACTG Chr14:64071458..64071478 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035095