Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30512
Trapped Gene
Olfr287 (ENSMUSG00000075427)
Vector Insertion
Chr 15: 98019564 - 98040555
Public Clones IST11391G12BBF2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646282 (Chr15:98040435..98040554 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTGTTTCTCGGGACAGC Chr15:98040476..98040495 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646282 (Chr15:98040435..98040554 -)
Downstram Exon
ENSMUSE00000646281 (Chr15:98019565..98019684 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTGTTTCTCGGGACAGC Chr15:98040476..98040495 60.53 55 GCTGTCCCGAGAAACAGAGA Chr15:98019584..98019603 60.53 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646283 Chr15:98051239..98051408 AGGCCCACAGCCCTATAAAT Chr15:98051355..98051374 59.82 50
upstream ENSMUSE00000646282 Chr15:98040435..98040554 TCTCTGTTTCTCGGGACAGC Chr15:98040476..98040495 60.53 55
upstream ENSMUSE00000646281 Chr15:98019565..98019684 ATTCAGTGAAACGGCCTGAG Chr15:98019585..98019604 60.26 50

*** Putative Vector Insertion (Chr 15: 98019564 - 98040555) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646279 Chr15:98016448..98018221 GAAGCAGACGTCCAGGAAAG Chr15:98017965..98017984 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr15:98028487..98028507 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGCGTGACTGGGAAAACC Chr15:98028488..98028508 62.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075427