Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30521
Trapped Gene
C330007P06Rik (ENSMUSG00000006423)
Vector Insertion
Chr X: 34368230 - 34391158
Public Clones (sanger) (sanger) (ggtc) (ggtc) (ggtc) (cmhd) IST10800C2BBF1 (tigm)
IST12358A4 (tigm) IST11217D11 (tigm) IST11477E4 (tigm) IST10309H2 (tigm)
IST11477E4 (tigm) IST14331C3 (tigm) IST11549G10 (tigm) IST14712E9 (tigm)
IST14852C2 (tigm) IST10006G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363469 (ChrX:34388545..34391157 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363469 (ChrX:34388545..34391157 -)
Downstram Exon
ENSMUSE00000702162 (ChrX:34368231..34368237 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000316375 ChrX:34414030..34414106 No primer for this exon
upstream ENSMUSE00000206175 ChrX:34404004..34404154 No primer for this exon
upstream ENSMUSE00000316370 ChrX:34404004..34404298 No primer for this exon
upstream ENSMUSE00000206173 ChrX:34403619..34403736 No primer for this exon
upstream ENSMUSE00000206177 ChrX:34396847..34396888 No primer for this exon
upstream ENSMUSE00000206171 ChrX:34394278..34394416 No primer for this exon
upstream ENSMUSE00000206174 ChrX:34393325..34393414 No primer for this exon
upstream ENSMUSE00000465849 ChrX:34392634..34392726 No primer for this exon
upstream ENSMUSE00000702160 ChrX:34389114..34391157 No primer for this exon
upstream ENSMUSE00000363469 ChrX:34388545..34391157 No primer for this exon
upstream ENSMUSE00000702162 ChrX:34368231..34368237 No primer for this exon

*** Putative Vector Insertion (Chr X: 34368230 - 34391158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702161 ChrX:34364087..34364164 No primer for this exon
downstream ENSMUSE00000337216 ChrX:34364025..34364164 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTCTGAAGAGCCACATA ChrX:34373120..34373140 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTTTGCGTGACTGGGAAA ChrX:34373094..34373114 60.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006423