Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30528
Trapped Gene
Rab11fip4 (ENSMUSG00000017639)
Vector Insertion
Chr 11: 79434058 - 79474328
Public Clones IST12508E9 (tigm) IST14778D10 (tigm) IST14758F11 (tigm) IST14958D6 (tigm)
IST13130E9 (tigm) IST14778D6 (tigm) IST13301F8 (tigm) IST12508E9 (tigm)
IST10229G4 (tigm) IST11069B8 (tigm) IST11816D2 (tigm) IST13361E7 (tigm)
IST14722F6 (tigm) IST14722E3 (tigm) IST14557B8 (tigm) IST10229G4 (tigm)
IST12474E4 (tigm) IST14313D5 (tigm) IST14220F11 (tigm) IST13479G10 (tigm)
IST12464B7 (tigm) IST14830E3 (tigm) IST12596D4 (tigm) IST14862C6 (tigm)
IST13849H9 (tigm) IST10732E11BBF1 (tigm) IST12800F2 (tigm) IST15086A11 (tigm)
IST14759F4 (tigm) IST11069B8 (tigm) IST14607D4 (tigm) IST15086A11 (tigm)
IST10830G5 (tigm) IST14959H7 (tigm) IST10732E11 (tigm) IST14813F11 (tigm)
IST11294G4 (tigm) IST13955G6 (tigm) IST14312C6 (tigm) IST14620D11 (tigm)
IST12474E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108452 (Chr11:79433969..79434057 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108452 (Chr11:79433969..79434057 +)
Downstram Exon
ENSMUSE00000578189 (Chr11:79474329..79474358 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405301 Chr11:79404518..79404936 No primer for this exon
upstream ENSMUSE00000108441 Chr11:79433131..79433218 No primer for this exon
upstream ENSMUSE00000108452 Chr11:79433969..79434057 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79434058 - 79474328) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578189 Chr11:79474329..79474358 No primer for this exon
downstream ENSMUSE00000108453 Chr11:79494290..79494513 No primer for this exon
downstream ENSMUSE00000711083 Chr11:79496843..79497037 No primer for this exon
downstream ENSMUSE00000712624 Chr11:79496843..79497037 No primer for this exon
downstream ENSMUSE00000587041 Chr11:79497725..79497859 No primer for this exon
downstream ENSMUSE00000676062 Chr11:79497725..79497859 No primer for this exon
downstream ENSMUSE00000587040 Chr11:79498103..79498138 No primer for this exon
downstream ENSMUSE00000676061 Chr11:79498103..79498138 No primer for this exon
downstream ENSMUSE00000587039 Chr11:79498530..79498629 No primer for this exon
downstream ENSMUSE00000676060 Chr11:79498530..79498629 No primer for this exon
downstream ENSMUSE00000587038 Chr11:79498888..79498991 No primer for this exon
downstream ENSMUSE00000676059 Chr11:79498888..79498991 No primer for this exon
downstream ENSMUSE00000108495 Chr11:79500054..79500194 No primer for this exon
downstream ENSMUSE00000587037 Chr11:79500054..79500194 No primer for this exon
downstream ENSMUSE00000108440 Chr11:79503117..79503198 No primer for this exon
downstream ENSMUSE00000587036 Chr11:79503117..79503198 No primer for this exon
downstream ENSMUSE00000108494 Chr11:79503960..79504097 No primer for this exon
downstream ENSMUSE00000587035 Chr11:79503960..79504097 No primer for this exon
downstream ENSMUSE00000108493 Chr11:79504174..79504329 No primer for this exon
downstream ENSMUSE00000587034 Chr11:79504174..79504329 No primer for this exon
downstream ENSMUSE00000108446 Chr11:79505258..79505401 No primer for this exon
downstream ENSMUSE00000587033 Chr11:79505258..79505401 No primer for this exon
downstream ENSMUSE00000349652 Chr11:79506225..79511524 No primer for this exon
downstream ENSMUSE00000587032 Chr11:79506225..79507514 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGAAGAACAGTGGCTCA Chr11:79470057..79470077 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAATTTAAACGTGACTGGGAAAAC Chr11:79446100..79446124 58.6 33.33 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017639