Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30536
Trapped Gene
Slc10a7 (ENSMUSG00000031684)
Vector Insertion
Chr 8: 81055058 - 81102617
Public Clones IST10752G3 (tigm) IST10739E6 (tigm) IST10600A12 (tigm) IST10255D3 (tigm)
IST14771E2 (tigm) IST11061B9 (tigm) IST12511D10 (tigm) IST10581C6 (tigm)
IST14782F6 (tigm) IST12767A11BBF1 (tigm) IST12878C12 (tigm) IST10160F3 (tigm)
IST11831C3 (tigm) IST14950G7 (tigm) IST10752G3 (tigm) IST10741G11 (tigm)
IST11471B5 (tigm) IST10667C1 (tigm) IST14225A12 (tigm) IST10255D3BBF1 (tigm)
IST14067F10 (tigm) IST14837C12 (tigm) IST10222H11 (tigm) IST10208B11 (tigm)
IST12124B7HMR1 (tigm) IST11061B9 (tigm) IST12012E11 (tigm) IST10685F5 (tigm)
IST12041F2 (tigm) IST12415H10 (tigm) IST10111F6 (tigm) IST10906H9 (tigm)
IST10140A1 (tigm) IST12415H10 (tigm) IST12159C7HMR1 (tigm) IST10531C10 (tigm)
IST10662A4 (tigm) IST11557D6 (tigm) IST10118G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249095 (Chr8:81054982..81055057 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249095 (Chr8:81054982..81055057 +)
Downstram Exon
ENSMUSE00000249088 (Chr8:81102618..81102656 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404952 Chr8:81033267..81033573 AATGGTTCATGGTCGGGATA Chr8:81033502..81033521 60.01 45
upstream ENSMUSE00000445432 Chr8:81033361..81033573 AATGGTTCATGGTCGGGATA Chr8:81033502..81033521 60.01 45
upstream ENSMUSE00000211734 Chr8:81039485..81039567 CGTCGCAACGATATTCTTCA Chr8:81039522..81039541 59.83 45
upstream ENSMUSE00000581693 Chr8:81049061..81049197 ATCCATCAACGAGTGGCTTT Chr8:81049171..81049190 59.56 45
upstream ENSMUSE00000581696 Chr8:81049061..81049197 ATCCATCAACGAGTGGCTTT Chr8:81049171..81049190 59.56 45
upstream ENSMUSE00000249095 Chr8:81054982..81055057 AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45
upstream ENSMUSE00000581692 Chr8:81054982..81055057 AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45

*** Putative Vector Insertion (Chr 8: 81055058 - 81102617) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249088 Chr8:81102618..81102656 No primer for this exon
downstream ENSMUSE00000606946 Chr8:81102618..81102656 No primer for this exon
downstream ENSMUSE00000249083 Chr8:81186886..81186921 AGCACCGGAGTCACAACAAT Chr8:81186911..81186930 60.58 50
downstream ENSMUSE00000606945 Chr8:81186886..81186921 AGCACCGGAGTCACAACAAT Chr8:81186911..81186930 60.58 50
downstream ENSMUSE00000606944 Chr8:81210484..81210567 GGAACCACCACCGTCATAAA Chr8:81210554..81210573 60.62 50
downstream ENSMUSE00000635949 Chr8:81210484..81210567 GGAACCACCACCGTCATAAA Chr8:81210554..81210573 60.62 50
downstream ENSMUSE00000211723 Chr8:81221065..81221230 GCTACTGCTGACCACACCAA Chr8:81221136..81221155 59.9 55
downstream ENSMUSE00000606943 Chr8:81221065..81221230 GCTACTGCTGACCACACCAA Chr8:81221136..81221155 59.9 55
downstream ENSMUSE00000211729 Chr8:81222419..81222470 AAGCTCAGCTGAACGGAGAC Chr8:81222443..81222462 59.75 55
downstream ENSMUSE00000682022 Chr8:81222419..81222470 AAGCTCAGCTGAACGGAGAC Chr8:81222443..81222462 59.75 55
downstream ENSMUSE00000211727 Chr8:81230774..81230847 TGGTGTGAACCCCGAGTTAT Chr8:81230798..81230817 60.23 50
downstream ENSMUSE00000682021 Chr8:81230774..81230847 TGGTGTGAACCCCGAGTTAT Chr8:81230798..81230817 60.23 50
downstream ENSMUSE00000211728 Chr8:81253517..81253662 CTCATGGCCTGCAAACACTA Chr8:81253557..81253576 59.86 50
downstream ENSMUSE00000606942 Chr8:81253517..81253662 CTCATGGCCTGCAAACACTA Chr8:81253557..81253576 59.86 50
downstream ENSMUSE00000341040 Chr8:81255508..81256050 CTGCACAAAGGCAGTACGAA Chr8:81255848..81255867 60.05 50
downstream ENSMUSE00000581694 Chr8:81255508..81257902 GAGGTACCTGACGCTTCTCG Chr8:81256058..81256077 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAGTCCATTAGTTGTGGT Chr8:81100010..81100031 60.42 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACACTGAATCGTGACTGG Chr8:81076097..81076118 59.74 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031684