Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30550
Trapped Gene
Kcnmb2 (ENSMUSG00000037610)
Vector Insertion
Chr 3: 32010778 - 32054968
Public Clones IST12130C3HMR1 (tigm) IST12184E4 (tigm) IST12184E4BBR1 (tigm) IST12187C7HMR1 (tigm)
IST12130E9HMR1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639648 (Chr3:32010764..32010777 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639648 (Chr3:32010764..32010777 +)
Downstram Exon
ENSMUSE00000708342 (Chr3:32054969..32055091 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGGCCACTGGTCCATATAAA Chr3:32055061..32055080 60.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714050 Chr3:31801429..31801847 GCGTGCCTGTCACTCCTATT Chr3:31801632..31801651 60.28 55
upstream ENSMUSE00000676068 Chr3:31801625..31801847 TGTCTAGCGTGCCTGTCACT Chr3:31801626..31801645 59.65 55
upstream ENSMUSE00000676067 Chr3:31807334..31807437 CAGCGTGCAGACTCCAATAA Chr3:31807377..31807396 60.01 50
upstream ENSMUSE00000712819 Chr3:31807334..31807433 CAGCGTGCAGACTCCAATAA Chr3:31807377..31807396 60.01 50
upstream ENSMUSE00000676066 Chr3:31988165..31988173 No primer for this exon
upstream ENSMUSE00000639648 Chr3:32010764..32010777 No primer for this exon

*** Putative Vector Insertion (Chr 3: 32010778 - 32054968) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457804 Chr3:32054963..32055091 CGGCCACTGGTCCATATAAA Chr3:32055061..32055080 60.71 50
downstream ENSMUSE00000708342 Chr3:32054969..32055091 CGGCCACTGGTCCATATAAA Chr3:32055061..32055080 60.71 50
downstream ENSMUSE00000676065 Chr3:32054982..32055091 CGGCCACTGGTCCATATAAA Chr3:32055061..32055080 60.71 50
downstream ENSMUSE00000343516 Chr3:32077753..32077923 GGTCATGGTCCCTGATTTTC Chr3:32077787..32077806 59.19 50
downstream ENSMUSE00000273088 Chr3:32080753..32080948 GCAGGCAAGGGTACTGAGAG Chr3:32080871..32080890 60.01 60
downstream ENSMUSE00000363455 Chr3:32096997..32098687 TTGATCCGTTGGATCCTCTC Chr3:32097277..32097296 60.01 50
downstream ENSMUSE00000676064 Chr3:32096997..32099100 TTGATCCGTTGGATCCTCTC Chr3:32097277..32097296 60.01 50
downstream ENSMUSE00000720281 Chr3:32096997..32099102 TTGATCCGTTGGATCCTCTC Chr3:32097277..32097296 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGACTTTAATCGCCTTGC Chr3:32016820..32016841 60.26 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGATATTTTCCCCCAAA Chr3:32016748..32016768 61.19 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037610