Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30552
Trapped Gene
Pkig (ENSMUSG00000035268)
Vector Insertion
Chr 2: 163484972 - 163519772
Public Clones IST14281A3 (tigm) IST15090E9 (tigm) IST12174B12BBR1 (tigm) IST15057H3 (tigm)
IST15000D8 (tigm) IST13154C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639333 (Chr2:163484886..163484971 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGCAGTGGAGGCTGTTGT Chr2:163484893..163484912 60.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639333 (Chr2:163484886..163484971 +)
Downstram Exon
ENSMUSE00000680142 (Chr2:163519773..163519892 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGCAGTGGAGGCTGTTGT Chr2:163484893..163484912 60.72 50 TCCTAGGTCAGATGGGAAGG Chr2:163519869..163519888 59.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427413 Chr2:163484135..163484228 No primer for this exon
upstream ENSMUSE00000639334 Chr2:163484187..163484228 No primer for this exon
upstream ENSMUSE00000639333 Chr2:163484886..163484971 AATGCAGTGGAGGCTGTTGT Chr2:163484893..163484912 60.72 50

*** Putative Vector Insertion (Chr 2: 163484972 - 163519772) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680142 Chr2:163519773..163519892 TCCTAGGTCAGATGGGAAGG Chr2:163519869..163519888 59.09 55
downstream ENSMUSE00000328300 Chr2:163529222..163529291 GCCTGCATCTCTTCAGGTTT Chr2:163529273..163529292 59.43 50
downstream ENSMUSE00000328292 Chr2:163546864..163547037 TCCGAGTAGGAGGACTCGAC Chr2:163546918..163546937 59.4 60
downstream ENSMUSE00000427401 Chr2:163551193..163551886 CACAGGCAGACTCAGGATGA Chr2:163551286..163551305 59.98 55
downstream ENSMUSE00000639332 Chr2:163551193..163551894 CACAGGCAGACTCAGGATGA Chr2:163551286..163551305 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCAGAGTTCCAGCCCTAA Chr2:163490978..163490998 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGACCAGCAGAGTTCCAG Chr2:163499972..163499992 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035268