Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30565
Trapped Gene
Gria4 (ENSMUSG00000025892)
Vector Insertion
Chr 9: 4664767 - 4793969
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) IST14317E9 (tigm)
IST14873E3 (tigm) IST14328E1 (tigm) IST12319F2 (tigm) IST11610G8 (tigm)
IST14515F8 (tigm) IST11323B9 (tigm) IST10264B8 (tigm) IST14435B5 (tigm)
IST14541C1 (tigm) IST14525E2 (tigm) IST14486D11 (tigm) IST10915F6 (tigm)
IST15076B4 (tigm) IST15054F8 (tigm) IST12222A3HMR1 (tigm) IST10945H3 (tigm)
IST14396E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153926 (Chr9:4793810..4793968 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCCCCTTTCAATTTGGT Chr9:4793863..4793882 60.3 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153926 (Chr9:4793810..4793968 -)
Downstram Exon
ENSMUSE00000260428 (Chr9:4664768..4665007 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCCCCTTTCAATTTGGT Chr9:4793863..4793882 60.3 45 AAGCACGAACTGGCTCTCTC Chr9:4664837..4664856 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455153 Chr9:4795845..4796142 CGACTTGGAGGGCATAAAAA Chr9:4796004..4796023 60.07 45
upstream ENSMUSE00000455170 Chr9:4795187..4795363 GCAGGCAGATTGTCTTGTTG Chr9:4795242..4795261 59.44 50
upstream ENSMUSE00000153926 Chr9:4793810..4793968 GAAGCCCCTTTCAATTTGGT Chr9:4793863..4793882 60.3 45
upstream ENSMUSE00000260428 Chr9:4664768..4665007 GAGAGAGCCAGTTCGTGCTT Chr9:4664859..4664878 59.75 55

*** Putative Vector Insertion (Chr 9: 4664767 - 4793969) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260405 Chr9:4537635..4537819 CACTGACATGCCATCCATTC Chr9:4537738..4537757 59.92 50
downstream ENSMUSE00000260376 Chr9:4519486..4519539 GGTAGCCTTTGACGTGCTTC Chr9:4519484..4519503 59.88 55
downstream ENSMUSE00000260353 Chr9:4513223..4513381 CCAGCGATCCATTAGTTTCG Chr9:4513249..4513268 60.6 50
downstream ENSMUSE00000540099 Chr9:4503562..4503729 TTCAGCCATTACCAAGACACC Chr9:4503663..4503683 59.99 47.62
downstream ENSMUSE00000260319 Chr9:4502374..4502478 TTGAACATTCCCAGTCAGTCC Chr9:4502424..4502444 59.96 47.62
downstream ENSMUSE00000260300 Chr9:4480178..4480288 CAAGAGTAGGCGCATCTTGA Chr9:4480209..4480228 59.17 50
downstream ENSMUSE00000540096 Chr9:4472012..4472218 TGTTTCGCAATTTCAGATGC Chr9:4472096..4472115 59.82 40
downstream ENSMUSE00000540095 Chr9:4464114..4464484 CACTGGGTCCTTCTTTTCCA Chr9:4464180..4464199 60.08 50
downstream ENSMUSE00000540094 Chr9:4461906..4462104 ACCATACGCCTCCAACAATC Chr9:4462048..4462067 59.82 50
downstream ENSMUSE00000540092 Chr9:4456005..4456252 CTCCCACTTTCATCGTGTCA Chr9:4456038..4456057 59.68 50
downstream ENSMUSE00000540086 Chr9:4432773..4432887 TTGTCCAAGAGGCCTTGTTC Chr9:4432812..4432831 60.23 50
downstream ENSMUSE00000540091 Chr9:4427030..4427144 TCTAAGACGCCTGCCTCACT Chr9:4427072..4427091 60.16 55
downstream ENSMUSE00000540090 Chr9:4424320..4424454 CCTCTGCCCTGGACTTGTAA Chr9:4424312..4424331 60.25 55
downstream ENSMUSE00000455093 Chr9:4417896..4420316 CCTAAGGTACCCCACCCACT Chr9:4419889..4419908 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAATGGCTGTGGTGAGAT Chr9:4736967..4736987 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAATGGCTGTGGTGAGAT Chr9:4736967..4736987 59.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025892