Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30573
Trapped Gene
Smad1 (ENSMUSG00000031681)
Vector Insertion
Chr 8: 81895682 - 81923368
Public Clones IST10124G5 (tigm) IST13014D10HMF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000486455 (Chr8:81923152..81923367 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000486455 (Chr8:81923152..81923367 -)
Downstram Exon
ENSMUSE00000720456 (Chr8:81895683..81896263 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTCTTCTTCATCGCCCTGT Chr8:81895979..81895998 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457154 Chr8:81923152..81923417 No primer for this exon
upstream ENSMUSE00000486455 Chr8:81923152..81923367 No primer for this exon
upstream ENSMUSE00000400890 Chr8:81895683..81896263 CTGCATCAACCCCTACCACT Chr8:81895704..81895723 59.99 55
upstream ENSMUSE00000720456 Chr8:81895683..81896263 CTGCATCAACCCCTACCACT Chr8:81895704..81895723 59.99 55

*** Putative Vector Insertion (Chr 8: 81895682 - 81923368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211706 Chr8:81880111..81880368 GAGAGTTGGGGTAGCTGCTG Chr8:81880161..81880180 60.01 60
downstream ENSMUSE00000457143 Chr8:81879846..81879895 AGAGCAGAGGCTGGAACAAC Chr8:81879830..81879849 59.6 55
downstream ENSMUSE00000211705 Chr8:81877229..81877345 TCTTCAGGAGGCAGGTAAGC Chr8:81877287..81877306 59.57 55
downstream ENSMUSE00000581679 Chr8:81873490..81873711 TTCCGGTTAACGTTGGAGAG Chr8:81873506..81873525 60.1 50
downstream ENSMUSE00000581678 Chr8:81867553..81867809 GAACCCGTGGTTCACAGACT Chr8:81867585..81867604 60.01 55
downstream ENSMUSE00000681965 Chr8:81865479..81867809 CAAACGAAATCCACGTTGTG Chr8:81865988..81866007 60 45
downstream ENSMUSE00000457128 Chr8:81862300..81863691 GATGATTCAACGTGGGCTCT Chr8:81863119..81863138 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCCAAGATTTGCTATGG Chr8:81917370..81917390 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCCAAGATTTGCTATGG Chr8:81917370..81917390 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031681