Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30603
Trapped Gene
BX284111.7 (ENSMUSG00000079518)
Vector Insertion
Chr X: 75715282 - 75727801
Public Clones IST12760H1BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697798 (ChrX:75727765..75727800 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697798 (ChrX:75727765..75727800 -)
Downstram Exon
ENSMUSE00000697797 (ChrX:75715283..75716143 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGTTCAAACCTCCGAAGTC ChrX:75715781..75715800 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697803 ChrX:75829108..75829194 TGCTAGCGCGTAGTAGCTGA ChrX:75829120..75829139 60.08 55
upstream ENSMUSE00000717524 ChrX:75766110..75766160 ACAAGCGAAAAATGGGAAGG ChrX:75766111..75766130 61.33 45
upstream ENSMUSE00000697801 ChrX:75762778..75762917 CGGGGATGTTCAGAACTCAT ChrX:75762811..75762830 59.93 50
upstream ENSMUSE00000697800 ChrX:75738588..75738656 TCTTCTGTGTGGCCTGATGT ChrX:75738635..75738654 59.26 50
upstream ENSMUSE00000697799 ChrX:75729090..75729250 AACATTGAGCGTGAGTGCAG ChrX:75729148..75729167 60.06 50
upstream ENSMUSE00000697798 ChrX:75727765..75727800 No primer for this exon
upstream ENSMUSE00000697797 ChrX:75715283..75716143 CCTGAAGCACCAGTGTCTGA ChrX:75715531..75715550 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCCGCTTCTTCCTGAGTA ChrX:75724772..75724792 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCCGCTTCTTCCTGAGTA ChrX:75724772..75724792 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079518