Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30606
Trapped Gene
2410076I21Rik (ENSMUSG00000074269)
Vector Insertion
Chr 9: 58513639 - 58559913
Public Clones IST15006H12 (tigm) IST12758A7BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636438 (Chr9:58559823..58559912 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCCGGGAGTCTTGTCCTC Chr9:58559874..58559893 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636438 (Chr9:58559823..58559912 -)
Downstram Exon
ENSMUSE00000636436 (Chr9:58513640..58513723 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCCGGGAGTCTTGTCCTC Chr9:58559874..58559893 60.46 55 CTTGCTGCCAATGAGTGAAA Chr9:58513675..58513694 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636439 Chr9:58589194..58589364 ATGTCTGAAGCGGGAAATGT Chr9:58589330..58589349 59.56 45
upstream ENSMUSE00000636438 Chr9:58559823..58559912 AATCCGGGAGTCTTGTCCTC Chr9:58559874..58559893 60.46 55
upstream ENSMUSE00000636436 Chr9:58513640..58513723 TTTCACTCATTGGCAGCAAG Chr9:58513697..58513716 59.99 45

*** Putative Vector Insertion (Chr 9: 58513639 - 58559913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636435 Chr9:58507981..58508178 CGAAACATTCGGCTCTTGTT Chr9:58508137..58508156 60.25 45
downstream ENSMUSE00000636434 Chr9:58505564..58505650 ATACACACGTGCTGCTCCAG Chr9:58505597..58505616 59.93 55
downstream ENSMUSE00000636433 Chr9:58500686..58500913 ATAGGCGAGGGTCAGCTTCT Chr9:58500856..58500875 60.37 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGTTTTTAATCGCCTTGC Chr9:58538850..58538871 60.12 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGCAGAGTTGTGATGT Chr9:58514867..58514887 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074269