Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30609
Trapped Gene
Ccdc142 (ENSMUSG00000079511)
Vector Insertion
Chr 6: 83058084 - 83058372
Public Clones IST11724D4 (tigm) IST12445F11BBF1 (tigm) IST13944F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653780 (Chr6:83058085..83058371 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCAGACCACTGAACTGC Chr6:83058098..83058117 60.72 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653780 (Chr6:83058085..83058371 +)
Downstram Exon
ENSMUSE00000653779 (Chr6:83058085..83059197 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCAGACCACTGAACTGC Chr6:83058098..83058117 60.72 60 TTCATTGTTTCCGACATCCA Chr6:83058567..83058586 59.9 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697511 Chr6:83051611..83052632 CTTTGCCTCCACTCGCTAAC Chr6:83051706..83051725 60.01 55
upstream ENSMUSE00000718596 Chr6:83051611..83052632 CTTTGCCTCCACTCGCTAAC Chr6:83051706..83051725 60.01 55
upstream ENSMUSE00000697520 Chr6:83052952..83053038 CTGCCTCAGGAGTGTGAGAA Chr6:83052957..83052976 59.12 55
upstream ENSMUSE00000653787 Chr6:83053114..83053263 TCCCCTCTTGGATAGCCTTC Chr6:83053205..83053224 60.54 55
upstream ENSMUSE00000653786 Chr6:83053396..83053526 CTGTACCCTGCAGACCACCT Chr6:83053421..83053440 60.17 60
upstream ENSMUSE00000653785 Chr6:83053606..83053719 AGCTGGGCCTAGAGATCCAC Chr6:83053679..83053698 60.76 60
upstream ENSMUSE00000653784 Chr6:83057047..83057161 AACAAGCCACACAAGGCTTC Chr6:83057093..83057112 60.3 50
upstream ENSMUSE00000653783 Chr6:83057449..83057626 CCTCCCAGTGACCCTAGTGA Chr6:83057451..83057470 60.1 60
upstream ENSMUSE00000653781 Chr6:83057749..83057948 GAGTGGTCAGGGAGGTTCTG Chr6:83057784..83057803 59.68 60

*** Putative Vector Insertion (Chr 6: 83058084 - 83058372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653779 Chr6:83058085..83059197 TTCATTGTTTCCGACATCCA Chr6:83058567..83058586 59.9 40
downstream ENSMUSE00000653780 Chr6:83058085..83058371 GGGAGACTCCAAGACGAAGA Chr6:83058180..83058199 59.38 55
downstream ENSMUSE00000697509 Chr6:83059308..83059420 GCGATCACAGAGCAGTTGAG Chr6:83059376..83059395 59.73 55
downstream ENSMUSE00000697508 Chr6:83059516..83059931 CCCTTCACCACCCAAACTTA Chr6:83059842..83059861 59.82 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGCAGCCTCAATAATCG Chr6:83058121..83058141 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGTCCAGACCACTGAACT Chr6:83058096..83058117 59.74 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079511