Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30611
Trapped Gene
AC073946.23-201 (ENSMUSG00000001995)
Vector Insertion
Chr 8: 127977200 - 127988327
Public Clones IST10190H8 (tigm) IST12680E7HMF1 (tigm) IST12680E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316737 (Chr8:127988052..127988326 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316737 (Chr8:127988052..127988326 -)
Downstram Exon
ENSMUSE00000356496 (Chr8:127977201..127977458 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633683 Chr8:128015011..128016610 No primer for this exon
upstream ENSMUSE00000633682 Chr8:128005948..128006081 No primer for this exon
upstream ENSMUSE00000316679 Chr8:128004054..128004242 No primer for this exon
upstream ENSMUSE00000579308 Chr8:127998724..127998898 No primer for this exon
upstream ENSMUSE00000463823 Chr8:127997398..127997501 No primer for this exon
upstream ENSMUSE00000316750 Chr8:127993648..127993805 No primer for this exon
upstream ENSMUSE00000316742 Chr8:127992075..127992651 No primer for this exon
upstream ENSMUSE00000316737 Chr8:127988052..127988326 No primer for this exon
upstream ENSMUSE00000356496 Chr8:127977201..127977458 No primer for this exon

*** Putative Vector Insertion (Chr 8: 127977200 - 127988327) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316662 Chr8:127975819..127975902 No primer for this exon
downstream ENSMUSE00000316716 Chr8:127974233..127974333 No primer for this exon
downstream ENSMUSE00000316707 Chr8:127973781..127973884 No primer for this exon
downstream ENSMUSE00000213775 Chr8:127971407..127971792 No primer for this exon
downstream ENSMUSE00000316813 Chr8:127968386..127968610 No primer for this exon
downstream ENSMUSE00000213787 Chr8:127966483..127966636 No primer for this exon
downstream ENSMUSE00000213784 Chr8:127963164..127963383 No primer for this exon
downstream ENSMUSE00000677989 Chr8:127957081..127957209 No primer for this exon
downstream ENSMUSE00000316637 Chr8:127957078..127957209 No primer for this exon
downstream ENSMUSE00000677998 Chr8:127947093..127947146 No primer for this exon
downstream ENSMUSE00000213788 Chr8:127946479..127946602 No primer for this exon
downstream ENSMUSE00000213778 Chr8:127945781..127945862 No primer for this exon
downstream ENSMUSE00000316788 Chr8:127941963..127943191 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCGAGACTGTGGAAATGAC Chr8:127988290..127988310 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCGAGACTGTGGAAATGAC Chr8:127988290..127988310 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001995