Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30612
Trapped Gene
Ano6 (ENSMUSG00000064210)
Vector Insertion
Chr 15: 95796455 - 95798053
Public Clones IST12695D10BBF1 (tigm) IST12214G6 (tigm) IST12100F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275033 (Chr15:95796252..95796454 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTACACCATGGACGGCTACA Chr15:95796341..95796360 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275033 (Chr15:95796252..95796454 +)
Downstram Exon
ENSMUSE00000275052 (Chr15:95798054..95798159 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTACACCATGGACGGCTACA Chr15:95796341..95796360 59.99 50 GGCAATCACGTGCCAATAGT Chr15:95798132..95798151 60.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501868 Chr15:95621274..95621487 ACGACGATGAGGATGGAGAC Chr15:95621464..95621483 60.08 55
upstream ENSMUSE00000552654 Chr15:95694656..95694738 CCACCTTTGGATCACTGGAG Chr15:95694689..95694708 60.5 55
upstream ENSMUSE00000552653 Chr15:95724844..95724972 CGAATCGACTTCATCCTCGT Chr15:95724895..95724914 60.22 50
upstream ENSMUSE00000552652 Chr15:95742736..95742801 GCAGCTGGAAGCAACAAGAT Chr15:95742780..95742799 60.55 50
upstream ENSMUSE00000552651 Chr15:95743803..95744087 CTTTTGAGAAGAGCCGGATG Chr15:95744008..95744027 59.95 50
upstream ENSMUSE00000552650 Chr15:95744303..95744416 TCATCCTCTCTCGGGTCAAA Chr15:95744310..95744329 60.74 50
upstream ENSMUSE00000552648 Chr15:95746384..95746499 AGCGAGCGTTACCTCCTGTA Chr15:95746423..95746442 60.04 55
upstream ENSMUSE00000552647 Chr15:95750675..95750809 TGGGCTATTACACGCAGATG Chr15:95750716..95750735 59.71 50
upstream ENSMUSE00000552646 Chr15:95757955..95758060 CAGTGTGACAGGCTGTGTCC Chr15:95758004..95758023 60.37 60
upstream ENSMUSE00000552645 Chr15:95762214..95762274 TTTTGGAACCCTGATCTTCG Chr15:95762234..95762253 60.04 45
upstream ENSMUSE00000552642 Chr15:95771641..95771783 ATGGGACACCGTTGAGCTAC Chr15:95771693..95771712 60 55
upstream ENSMUSE00000679553 Chr15:95773585..95773614 TCTGATGGCTGAGAGCCTTT Chr15:95773590..95773609 60.1 50
upstream ENSMUSE00000347512 Chr15:95773829..95773906 GCATCCCATTTACCACCTGT Chr15:95773839..95773858 59.68 50
upstream ENSMUSE00000275040 Chr15:95778703..95778928 CCCGATCCAGAAGTACCTGA Chr15:95778804..95778823 60.06 55
upstream ENSMUSE00000275079 Chr15:95779922..95780091 TTCTTCAAGGGCAAATTCGT Chr15:95780020..95780039 59.69 40
upstream ENSMUSE00000275072 Chr15:95780290..95780387 CTGACCACACAGCTGACGAT Chr15:95780317..95780336 59.9 55
upstream ENSMUSE00000275066 Chr15:95786322..95786452 GGCAAGCTGGGATTGTTCTA Chr15:95786416..95786435 60.21 50
upstream ENSMUSE00000275059 Chr15:95792507..95792712 GCTCACAACCCAGTTTAGGC Chr15:95792610..95792629 59.74 55
upstream ENSMUSE00000275033 Chr15:95796252..95796454 TTACACCATGGACGGCTACA Chr15:95796341..95796360 59.99 50

*** Putative Vector Insertion (Chr 15: 95796455 - 95798053) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000275052 Chr15:95798054..95798159 GGCAATCACGTGCCAATAGT Chr15:95798132..95798151 60.92 50
downstream ENSMUSE00000474865 Chr15:95802926..95805180 ACAGAGGCGATTAAGGCTGA Chr15:95803571..95803590 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATACATTGGGCTTGGTA Chr15:95796420..95796440 60.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCATACATTGGGCTTGGTA Chr15:95796420..95796440 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064210