Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30618
Trapped Gene
4930433N12Rik (ENSMUSG00000042360)
Vector Insertion
Chr 9: 3134875 - 3190806
Public Clones IST13746F8 (tigm) IST14154B9 (tigm) IST12702A2BBF1 (tigm) IST14780D8 (tigm)
IST12490C10BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000262182 (Chr9:3190583..3190805 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCAGAGGATTTCGAGGA Chr9:3190630..3190649 59.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000262182 (Chr9:3190583..3190805 -)
Downstram Exon
ENSMUSE00000262160 (Chr9:3134876..3135102 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCAGAGGATTTCGAGGA Chr9:3190630..3190649 59.36 50 CATCAAAGGGTTCTGGGTGT Chr9:3134939..3134958 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704006 Chr9:3199537..3199782 TTTAGGAGCGCAAAAAGTGG Chr9:3199689..3199708 60.37 45
upstream ENSMUSE00000704005 Chr9:3192820..3193048 AGGCCAGCTACATCAAATGG Chr9:3192990..3193009 60.1 50
upstream ENSMUSE00000704004 Chr9:3192312..3192412 GCAGTATTGTTGCCGATTGA Chr9:3192345..3192364 59.69 45
upstream ENSMUSE00000262182 Chr9:3190583..3190805 CTTCCAGAGGATTTCGAGGA Chr9:3190630..3190649 59.36 50
upstream ENSMUSE00000262160 Chr9:3134876..3135102 ACCCAGAACCCTTTGATGTG Chr9:3134959..3134978 59.82 50

*** Putative Vector Insertion (Chr 9: 3134875 - 3190806) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340445 Chr9:3133847..3134024 TGGATATCCTCGATGGTTGA Chr9:3133965..3133984 58.87 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGACTGAGCATGGATTG Chr9:3148806..3148826 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGACTGAGCATGGATTG Chr9:3148806..3148826 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042360