Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30619
Trapped Gene
Fnbp1 (ENSMUSG00000075415)
Vector Insertion
Chr 2: 30914408 - 30938599
Public Clones (sanger) (sanger) (sanger) (sanger) CMHD-GT_545C5-5S (cmhd) (cmhd)
CMHD-GT_469A3-3 (cmhd) (cmhd) IST13234F7 (tigm) IST14575D8 (tigm)
IST14700E5 (tigm) IST14434F1 (tigm) IST14308H4 (tigm) IST13672D3 (tigm)
IST13471A9 (tigm) IST15035H12 (tigm) IST13546A2 (tigm) IST14423B3 (tigm)
IST14595C5 (tigm) IST14848F10 (tigm) IST10335D1 (tigm) IST14531F12 (tigm)
IST13643C8 (tigm) IST12040F5 (tigm) IST14547D2 (tigm) IST13287G1 (tigm)
IST11614G9 (tigm) IST10326C12 (tigm) IST13220G5 (tigm) IST10650B10 (tigm)
IST14017F7 (tigm) IST14700E5 (tigm) IST14390E5 (tigm) IST13557C2 (tigm)
IST11008D1 (tigm) IST14611C9 (tigm) IST14966G8 (tigm) IST13557C2 (tigm)
IST11695C11 (tigm) IST14312D6 (tigm) IST13400G6 (tigm) IST12687B5HMF1 (tigm)
IST14379H1 (tigm) IST14449E7 (tigm) IST11615B3 (tigm) IST14017F7 (tigm)
IST14156C5 (tigm) IST10335D1 (tigm) IST13287G1 (tigm) IST10161H11 (tigm)
IST13775G10 (tigm) IST11098H4 (tigm) IST12435A9 (tigm) IST14102E12 (tigm)
IST14336D9 (tigm) IST14307F5 (tigm) IST14216F7 (tigm) IST12343G9 (tigm)
IST12341F9 (tigm) IST14423B3 (tigm) IST11008D1 (tigm) IST11202D1 (tigm)
IST11098H4 (tigm) IST14810F7 (tigm) IST10355H5 (tigm) IST10389G1 (tigm)
IST10326C12 (tigm) IST14902F2 (tigm) IST14574B3 (tigm) IST14623A2 (tigm)
IST13528H2 (tigm) IST10054A7 (tigm) IST11188F2 (tigm) IST13400G6 (tigm)
IST14660A4 (tigm) IST10387G10 (tigm) IST14974G10 (tigm) IST14816G9 (tigm)
IST14156C5 (tigm) IST13375D4 (tigm) IST13672D3 (tigm) IST10161H11 (tigm)
IST12343G9 (tigm) IST13903A3 (tigm) IST14816G9 (tigm) IST13471A9 (tigm)
IST12471H6 (tigm) IST13775G10 (tigm) IST10760A2 (tigm) IST11202D1 (tigm)
IST14336D9 (tigm) IST14575D8 (tigm) IST10355H5 (tigm) IST14899A7 (tigm)
IST12889A4 (tigm) IST14623A2 (tigm) IST12040F5 (tigm) IST14710C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000163541 (Chr2:30938494..30938598 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTGAGCGGGACTGTAAGG Chr2:30938568..30938587 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000163541 (Chr2:30938494..30938598 -)
Downstram Exon
ENSMUSE00000722142 (Chr2:30914409..30914537 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTGAGCGGGACTGTAAGG Chr2:30938568..30938587 59.73 55 TGGCGTATCTGAGCTTGTTG Chr2:30914490..30914509 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479781 Chr2:30997299..30997526 CTTTCCGCATTCACAAGGTT Chr2:30997383..30997402 60.11 45
upstream ENSMUSE00000662797 Chr2:30997299..30997528 CTTTCCGCATTCACAAGGTT Chr2:30997383..30997402 60.11 45
upstream ENSMUSE00000696139 Chr2:30997299..30997322 No primer for this exon
upstream ENSMUSE00000696122 Chr2:30971745..30971807 ATGGAAGATGGCCTGATGAA Chr2:30971788..30971807 60.43 45
upstream ENSMUSE00000696128 Chr2:30965016..30965028 No primer for this exon
upstream ENSMUSE00000696143 Chr2:30965016..30965029 No primer for this exon
upstream ENSMUSE00000696142 Chr2:30961422..30961429 No primer for this exon
upstream ENSMUSE00000281967 Chr2:30960762..30960877 CAAGGAGAGGACGGAGATTG Chr2:30960787..30960806 59.8 55
upstream ENSMUSE00000163540 Chr2:30952614..30952670 AACTCGAAGGAAGAGGAGGA Chr2:30952620..30952639 58.05 50
upstream ENSMUSE00000163542 Chr2:30951547..30951694 CAGCACGAGGTCATCTCTGA Chr2:30951617..30951636 60.14 55
upstream ENSMUSE00000163538 Chr2:30939543..30939605 GGCTCAGCAGCACATAGAAA Chr2:30939566..30939585 59.18 50
upstream ENSMUSE00000163541 Chr2:30938494..30938598 GTTTGAGCGGGACTGTAAGG Chr2:30938568..30938587 59.73 55
upstream ENSMUSE00000717061 Chr2:30914409..30914537 TACCCACATCCCCAACATCT Chr2:30914414..30914433 60.05 50
upstream ENSMUSE00000722142 Chr2:30914409..30914537 TACCCACATCCCCAACATCT Chr2:30914414..30914433 60.05 50

*** Putative Vector Insertion (Chr 2: 30914408 - 30938599) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696123 Chr2:30914128..30914133 No primer for this exon
downstream ENSMUSE00000281923 Chr2:30910948..30911094 CACCTCTGCGTACGTCTTCA Chr2:30911004..30911023 60.05 55
downstream ENSMUSE00000696119 Chr2:30910948..30911094 CACCTCTGCGTACGTCTTCA Chr2:30911004..30911023 60.05 55
downstream ENSMUSE00000568127 Chr2:30909544..30909738 GACACTGTGCGTTTCATTGG Chr2:30909619..30909638 60.16 50
downstream ENSMUSE00000696126 Chr2:30909511..30909738 GACACTGTGCGTTTCATTGG Chr2:30909619..30909638 60.16 50
downstream ENSMUSE00000662796 Chr2:30908755..30909738 TATCGATGCCACGGTACAAA Chr2:30908785..30908804 59.95 45
downstream ENSMUSE00000506828 Chr2:30908505..30908600 AGCAGTGGATTTTGGGTTTG Chr2:30908503..30908522 59.97 45
downstream ENSMUSE00000568126 Chr2:30908505..30908687 CTTTAGGCTCCGGAAGCAGT Chr2:30908489..30908508 60.88 55
downstream ENSMUSE00000696157 Chr2:30908505..30908657 AGCAGTGGATTTTGGGTTTG Chr2:30908503..30908522 59.97 45
downstream ENSMUSE00000696148 Chr2:30900402..30900416 No primer for this exon
downstream ENSMUSE00000604325 Chr2:30895925..30896034 CTCTGGTCCGTCTCCTTCTG Chr2:30895903..30895922 59.98 60
downstream ENSMUSE00000604324 Chr2:30892676..30892808 GGTGACTTCGGTGAGCTTCT Chr2:30892696..30892715 59.46 55
downstream ENSMUSE00000604323 Chr2:30892062..30892183 GTGACCGTCTGGTGTGTCTG Chr2:30892064..30892083 60.21 60
downstream ENSMUSE00000604322 Chr2:30891638..30891774 ATGTGTAGAGGGCCTTGCAG Chr2:30891622..30891641 60.28 55
downstream ENSMUSE00000568116 Chr2:30888550..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696131 Chr2:30888530..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000335812 Chr2:30888523..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696134 Chr2:30888519..30888708 CGTAGGAAGTGGGGACGTAA Chr2:30888558..30888577 59.99 55
downstream ENSMUSE00000696146 Chr2:30881727..30884403 GGAGAACAGGATCCGATGAA Chr2:30883457..30883476 60.01 50
downstream ENSMUSE00000696138 Chr2:30881726..30888708 AGCGGTAAATGTCACGTTCC Chr2:30882287..30882306 60 50
downstream ENSMUSE00000696149 Chr2:30881726..30884403 GGAGAACAGGATCCGATGAA Chr2:30883457..30883476 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCAAAGCTTTCCCTCGTT Chr2:30935576..30935596 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCAAAGCTTTCCCTCGTT Chr2:30935576..30935596 60.61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr2:30935517..30935537 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAAAAGGTAAGGGGTCTCG Chr2:30920479..30920499 59.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075415