Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30622
Trapped Gene
Dennd1a (ENSMUSG00000035392)
Vector Insertion
Chr 2: 37904244 - 37982169
Public Clones IST10821H7 (tigm) IST11012F6 (tigm) IST12615A6HMF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254197 (Chr2:37982049..37982168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254197 (Chr2:37982049..37982168 -)
Downstram Exon
ENSMUSE00000603295 (Chr2:37904245..37904314 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55 TCGTCGTGTAATCTGCCAAG Chr2:37904231..37904250 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715569 Chr2:38142633..38142867 CGGCTGGAGCGAGTACTTTA Chr2:38142839..38142858 60.53 55
upstream ENSMUSE00000719732 Chr2:38142633..38142867 CGGCTGGAGCGAGTACTTTA Chr2:38142839..38142858 60.53 55
upstream ENSMUSE00000603315 Chr2:38098922..38098992 TCCTAGGACAGGTGGCACTC Chr2:38098928..38098947 60.26 60
upstream ENSMUSE00000662608 Chr2:38098922..38098992 TCCTAGGACAGGTGGCACTC Chr2:38098928..38098947 60.26 60
upstream ENSMUSE00000567430 Chr2:38015327..38015370 AGAGGCAATTCCCAGAGGAC Chr2:38015339..38015358 60.6 55
upstream ENSMUSE00000603314 Chr2:38015327..38015370 AGAGGCAATTCCCAGAGGAC Chr2:38015339..38015358 60.6 55
upstream ENSMUSE00000567429 Chr2:37992446..37992495 No primer for this exon
upstream ENSMUSE00000693591 Chr2:37992446..37992495 No primer for this exon
upstream ENSMUSE00000254197 Chr2:37982049..37982168 CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55
upstream ENSMUSE00000693590 Chr2:37982049..37982168 CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55
upstream ENSMUSE00000603295 Chr2:37904245..37904314 CTTGGCAGATTACACGACGA Chr2:37904253..37904272 59.86 50
upstream ENSMUSE00000645543 Chr2:37904245..37904314 CTTGGCAGATTACACGACGA Chr2:37904253..37904272 59.86 50

*** Putative Vector Insertion (Chr 2: 37904244 - 37982169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645542 Chr2:37898859..37898939 TCAGGGATGGGAAGTCTGTG Chr2:37898865..37898884 61.07 55
downstream ENSMUSE00000693589 Chr2:37898859..37898939 TCAGGGATGGGAAGTCTGTG Chr2:37898865..37898884 61.07 55
downstream ENSMUSE00000645541 Chr2:37894672..37894725 GCTCTCTGCTATCAGGCACA Chr2:37894670..37894689 59.3 55
downstream ENSMUSE00000693588 Chr2:37894672..37894725 GCTCTCTGCTATCAGGCACA Chr2:37894670..37894689 59.3 55
downstream ENSMUSE00000645540 Chr2:37876876..37876986 CTGGCGTACAGATGCAACAT Chr2:37876903..37876922 59.75 50
downstream ENSMUSE00000693587 Chr2:37876876..37876986 CTGGCGTACAGATGCAACAT Chr2:37876903..37876922 59.75 50
downstream ENSMUSE00000645539 Chr2:37858894..37858994 CATGCTGCCAGTACATAGGG Chr2:37858915..37858934 59.17 55
downstream ENSMUSE00000693586 Chr2:37858894..37858994 CATGCTGCCAGTACATAGGG Chr2:37858915..37858934 59.17 55
downstream ENSMUSE00000645538 Chr2:37838580..37838625 TCCTATGAGGTAGGGCATGG Chr2:37838579..37838598 59.91 55
downstream ENSMUSE00000693585 Chr2:37838580..37838625 TCCTATGAGGTAGGGCATGG Chr2:37838579..37838598 59.91 55
downstream ENSMUSE00000567423 Chr2:37817161..37817262 TCATCAAAAGGGGTTTCCAG Chr2:37817164..37817183 59.9 45
downstream ENSMUSE00000645537 Chr2:37817161..37817262 TCATCAAAAGGGGTTTCCAG Chr2:37817164..37817183 59.9 45
downstream ENSMUSE00000254146 Chr2:37792139..37792264 GGTAGCTGCCAAAGAAAGCA Chr2:37792140..37792159 60.52 50
downstream ENSMUSE00000603306 Chr2:37792139..37792264 GGTAGCTGCCAAAGAAAGCA Chr2:37792140..37792159 60.52 50
downstream ENSMUSE00000693592 Chr2:37772362..37772365 No primer for this exon
downstream ENSMUSE00000254141 Chr2:37713888..37713992 CTGCAACTGTGTGGCATTCT Chr2:37713878..37713897 59.9 50
downstream ENSMUSE00000693584 Chr2:37713888..37713992 CTGCAACTGTGTGGCATTCT Chr2:37713878..37713897 59.9 50
downstream ENSMUSE00000254133 Chr2:37713538..37713625 TCACCGGAATTGAGAAGGTC Chr2:37713566..37713585 60.05 50
downstream ENSMUSE00000693583 Chr2:37713538..37713625 TCACCGGAATTGAGAAGGTC Chr2:37713566..37713585 60.05 50
downstream ENSMUSE00000254126 Chr2:37711636..37711676 GTGGACAGCCACTGATGGTA Chr2:37711621..37711640 59.55 55
downstream ENSMUSE00000693582 Chr2:37711636..37711676 GTGGACAGCCACTGATGGTA Chr2:37711621..37711640 59.55 55
downstream ENSMUSE00000254119 Chr2:37709513..37709584 CAGAATCGCACCACTTCCTT Chr2:37709542..37709561 60.26 50
downstream ENSMUSE00000693581 Chr2:37709513..37709584 CAGAATCGCACCACTTCCTT Chr2:37709542..37709561 60.26 50
downstream ENSMUSE00000567428 Chr2:37707916..37707972 TTTTGCTTCAAGCGGTTTTT Chr2:37707895..37707914 59.87 35
downstream ENSMUSE00000603305 Chr2:37700325..37700359 TTCTCGAAGTCTGGGGTCCT Chr2:37700308..37700327 61.16 55
downstream ENSMUSE00000254241 Chr2:37700297..37700428 AGAGGACACACAGCCGTTCT Chr2:37700377..37700396 59.91 55
downstream ENSMUSE00000603304 Chr2:37700297..37700320 GCCCAAAGTGGACTGTGATT Chr2:37700277..37700296 59.97 50
downstream ENSMUSE00000645536 Chr2:37672436..37672524 CTTGGGTCTCCTGACGACAT Chr2:37672464..37672483 60.11 55
downstream ENSMUSE00000693580 Chr2:37660592..37660720 CATAGTGTCGCAAGGGCTTT Chr2:37660673..37660692 60.27 50
downstream ENSMUSE00000645535 Chr2:37657535..37657793 GGACTCTCGGTCTCATCACC Chr2:37657709..37657728 59.64 60
downstream ENSMUSE00000693594 Chr2:37654514..37656770 CGAGAGCCCAGAGGTATGAG Chr2:37654904..37654923 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGTTCACTCCAGAAGCAAT Chr2:37967194..37967214 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTTCACTCCAGAAGCAAT Chr2:37967194..37967214 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035392