Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30633
Trapped Gene
Sfi1 (ENSMUSG00000023764)
Vector Insertion
Chr 11: 3070589 - 3077497
Public Clones IST12484H9BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682614 (Chr11:3077430..3077496 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTTCCGAATAGCTGAGCA Chr11:3077435..3077454 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682614 (Chr11:3077430..3077496 -)
Downstram Exon
ENSMUSE00000595523 (Chr11:3070590..3070707 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTTCCGAATAGCTGAGCA Chr11:3077435..3077454 59.98 50 GCTTGGCACATCTTCTGCTT Chr11:3070661..3070680 60.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462887 Chr11:3093363..3093466 TGTCTAGCGTCTGCTGAGGA Chr11:3093377..3093396 59.88 55
upstream ENSMUSE00000711080 Chr11:3093363..3093427 TGTCTAGCGTCTGCTGAGGA Chr11:3093377..3093396 59.88 55
upstream ENSMUSE00000715307 Chr11:3088944..3089059 No primer for this exon
upstream ENSMUSE00000717373 Chr11:3088944..3089059 No primer for this exon
upstream ENSMUSE00000719488 Chr11:3088944..3089059 No primer for this exon
upstream ENSMUSE00000656469 Chr11:3088896..3088920 CAGCTGAGGTTAATGGCTCA Chr11:3088897..3088916 59.02 50
upstream ENSMUSE00000581622 Chr11:3087243..3087413 TCATGCCTCACAAAACTGGA Chr11:3087274..3087293 60.24 45
upstream ENSMUSE00000581665 Chr11:3087243..3087413 TCATGCCTCACAAAACTGGA Chr11:3087274..3087293 60.24 45
upstream ENSMUSE00000682553 Chr11:3087243..3087429 TCATGCCTCACAAAACTGGA Chr11:3087274..3087293 60.24 45
upstream ENSMUSE00000595526 Chr11:3086068..3086139 GTGTGTGGCCAGAAAGTTCC Chr11:3086120..3086139 60.56 55
upstream ENSMUSE00000682618 Chr11:3086068..3086139 GTGTGTGGCCAGAAAGTTCC Chr11:3086120..3086139 60.56 55
upstream ENSMUSE00000717197 Chr11:3085571..3085977 TGTGGTTGCTGGAGTTTGAA Chr11:3085749..3085768 60.28 45
upstream ENSMUSE00000682617 Chr11:3079400..3079510 GAGGGAGTGGAAGCTCTGTG Chr11:3079422..3079441 59.99 60
upstream ENSMUSE00000717201 Chr11:3079400..3079510 GAGGGAGTGGAAGCTCTGTG Chr11:3079422..3079441 59.99 60
upstream ENSMUSE00000718371 Chr11:3079400..3079510 GAGGGAGTGGAAGCTCTGTG Chr11:3079422..3079441 59.99 60
upstream ENSMUSE00000595524 Chr11:3077430..3077524 AGGTTCCGAATAGCTGAGCA Chr11:3077435..3077454 59.98 50
upstream ENSMUSE00000656462 Chr11:3077430..3077524 AGGTTCCGAATAGCTGAGCA Chr11:3077435..3077454 59.98 50
upstream ENSMUSE00000682614 Chr11:3077430..3077496 AGGTTCCGAATAGCTGAGCA Chr11:3077435..3077454 59.98 50
upstream ENSMUSE00000595523 Chr11:3070590..3070707 GAAGCAGAAGATGTGCCAAG Chr11:3070684..3070703 58.6 50
upstream ENSMUSE00000656458 Chr11:3070590..3070707 GAAGCAGAAGATGTGCCAAG Chr11:3070684..3070703 58.6 50

*** Putative Vector Insertion (Chr 11: 3070589 - 3077497) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656455 Chr11:3065579..3065681 CTTGTCCTAGTCGCCACCTC Chr11:3065622..3065641 59.87 60
downstream ENSMUSE00000716140 Chr11:3065579..3065681 CTTGTCCTAGTCGCCACCTC Chr11:3065622..3065641 59.87 60
downstream ENSMUSE00000720944 Chr11:3065579..3065681 CTTGTCCTAGTCGCCACCTC Chr11:3065622..3065641 59.87 60
downstream ENSMUSE00000595500 Chr11:3064560..3064716 TCCTCCTATCTCGCTGGCTA Chr11:3064643..3064662 60.07 55
downstream ENSMUSE00000595521 Chr11:3064560..3064716 TCCTCCTATCTCGCTGGCTA Chr11:3064643..3064662 60.07 55
downstream ENSMUSE00000595520 Chr11:3059988..3060149 GACAAGCTCTGCCTCCACTC Chr11:3060040..3060059 60.14 60
downstream ENSMUSE00000682596 Chr11:3059988..3060149 GACAAGCTCTGCCTCCACTC Chr11:3060040..3060059 60.14 60
downstream ENSMUSE00000595519 Chr11:3057869..3057939 AGCCTCTTCTGCCTGTAGCA Chr11:3057892..3057911 60.3 55
downstream ENSMUSE00000682594 Chr11:3057869..3057939 AGCCTCTTCTGCCTGTAGCA Chr11:3057892..3057911 60.3 55
downstream ENSMUSE00000682613 Chr11:3057857..3057939 AGCCTCTTCTGCCTGTAGCA Chr11:3057892..3057911 60.3 55
downstream ENSMUSE00000581638 Chr11:3056775..3056867 TGGGTCACGTTGTCTTTGAA Chr11:3056808..3056827 60.13 45
downstream ENSMUSE00000682592 Chr11:3056775..3056867 TGGGTCACGTTGTCTTTGAA Chr11:3056808..3056827 60.13 45
downstream ENSMUSE00000595518 Chr11:3055402..3055499 ATGCAATGAGGGGGTCTGTA Chr11:3055400..3055419 60.34 50
downstream ENSMUSE00000682591 Chr11:3055402..3055499 ATGCAATGAGGGGGTCTGTA Chr11:3055400..3055419 60.34 50
downstream ENSMUSE00000595517 Chr11:3053435..3053501 GTGCACATACCGTAGCCACA Chr11:3053431..3053450 60.61 55
downstream ENSMUSE00000682589 Chr11:3053435..3053501 GTGCACATACCGTAGCCACA Chr11:3053431..3053450 60.61 55
downstream ENSMUSE00000595499 Chr11:3046165..3046295 CCATAGCCAGCCTCTGTACC Chr11:3046190..3046209 59.72 60
downstream ENSMUSE00000595516 Chr11:3046165..3046295 CCATAGCCAGCCTCTGTACC Chr11:3046190..3046209 59.72 60
downstream ENSMUSE00000595498 Chr11:3045244..3045325 TGAGACATCTTCTGCCTCCA Chr11:3045253..3045272 59.5 50
downstream ENSMUSE00000595515 Chr11:3045244..3045325 TGAGACATCTTCTGCCTCCA Chr11:3045253..3045272 59.5 50
downstream ENSMUSE00000595497 Chr11:3044795..3044973 ACACGAACCAGAACCTACGC Chr11:3044903..3044922 60.18 55
downstream ENSMUSE00000595514 Chr11:3044795..3044973 ACACGAACCAGAACCTACGC Chr11:3044903..3044922 60.18 55
downstream ENSMUSE00000595496 Chr11:3044220..3044295 CAAGAGCTGTGCAGAGTGGA Chr11:3044225..3044244 60.33 55
downstream ENSMUSE00000595513 Chr11:3044220..3044295 CAAGAGCTGTGCAGAGTGGA Chr11:3044225..3044244 60.33 55
downstream ENSMUSE00000500772 Chr11:3043698..3043793 CGCACACTTCAGTTTCTGCT Chr11:3043727..3043746 59.24 50
downstream ENSMUSE00000682571 Chr11:3043698..3043793 CGCACACTTCAGTTTCTGCT Chr11:3043727..3043746 59.24 50
downstream ENSMUSE00000595495 Chr11:3043263..3043339 AGCTGCCTGTTGTGCTGTCT Chr11:3043247..3043266 61.22 55
downstream ENSMUSE00000595512 Chr11:3043263..3043339 AGCTGCCTGTTGTGCTGTCT Chr11:3043247..3043266 61.22 55
downstream ENSMUSE00000595494 Chr11:3042311..3042413 No primer for this exon
downstream ENSMUSE00000595511 Chr11:3042311..3042413 No primer for this exon
downstream ENSMUSE00000595493 Chr11:3040140..3040236 AGTAACCTCTCGCCACTGGA Chr11:3040188..3040207 59.87 55
downstream ENSMUSE00000595510 Chr11:3040140..3040236 AGTAACCTCTCGCCACTGGA Chr11:3040188..3040207 59.87 55
downstream ENSMUSE00000595492 Chr11:3036949..3037109 AGAATCGCCAGTGCTGAAAC Chr11:3037052..3037071 60.41 50
downstream ENSMUSE00000595509 Chr11:3036949..3037109 AGAATCGCCAGTGCTGAAAC Chr11:3037052..3037071 60.41 50
downstream ENSMUSE00000595491 Chr11:3036628..3036702 GTCTCTGTGCCAGGAGTTGG Chr11:3036641..3036660 60.86 60
downstream ENSMUSE00000595508 Chr11:3036628..3036702 GTCTCTGTGCCAGGAGTTGG Chr11:3036641..3036660 60.86 60
downstream ENSMUSE00000595490 Chr11:3035946..3036020 CTGTTCTTGCTTCCGGACTG Chr11:3035975..3035994 60.96 55
downstream ENSMUSE00000595507 Chr11:3035946..3036020 CTGTTCTTGCTTCCGGACTG Chr11:3035975..3035994 60.96 55
downstream ENSMUSE00000595489 Chr11:3035738..3035833 GTGCCTTCTTCCTCCTCCTC Chr11:3035760..3035779 60.34 60
downstream ENSMUSE00000595506 Chr11:3035657..3035833 GTGCCTTCTTCCTCCTCCTC Chr11:3035760..3035779 60.34 60
downstream ENSMUSE00000682556 Chr11:3035657..3035833 GTGCCTTCTTCCTCCTCCTC Chr11:3035760..3035779 60.34 60
downstream ENSMUSE00000595486 Chr11:3035286..3035545 AGAAGTCTTGCCTGGACCAA Chr11:3035443..3035462 59.84 50
downstream ENSMUSE00000595505 Chr11:3035286..3035545 AGAAGTCTTGCCTGGACCAA Chr11:3035443..3035462 59.84 50
downstream ENSMUSE00000595504 Chr11:3034629..3034733 CCCAAGGCTGTACCACTCTG Chr11:3034615..3034634 60.7 60
downstream ENSMUSE00000682554 Chr11:3034629..3034733 CCCAAGGCTGTACCACTCTG Chr11:3034615..3034634 60.7 60
downstream ENSMUSE00000595485 Chr11:3034321..3034504 CCCAGGTAGGAAGGGTCTTG Chr11:3034407..3034426 60.86 60
downstream ENSMUSE00000713886 Chr11:3034321..3034504 CCCAGGTAGGAAGGGTCTTG Chr11:3034407..3034426 60.86 60
downstream ENSMUSE00000722175 Chr11:3034321..3034504 CCCAGGTAGGAAGGGTCTTG Chr11:3034407..3034426 60.86 60
downstream ENSMUSE00000656431 Chr11:3033075..3033210 ATCAAGGTCCCTGGGTAAGG Chr11:3033120..3033139 60.18 55
downstream ENSMUSE00000656474 Chr11:3033075..3033210 ATCAAGGTCCCTGGGTAAGG Chr11:3033120..3033139 60.18 55
downstream ENSMUSE00000508119 Chr11:3032890..3032951 CAAAGGTTCTGCTTGGTGGT Chr11:3032868..3032887 60.15 50
downstream ENSMUSE00000656430 Chr11:3032890..3032968 CAAAGGTTCTGCTTGGTGGT Chr11:3032868..3032887 60.15 50
downstream ENSMUSE00000656473 Chr11:3032890..3032968 CAAAGGTTCTGCTTGGTGGT Chr11:3032868..3032887 60.15 50
downstream ENSMUSE00000595488 Chr11:3032219..3032278 AGGTGAAGGTCCTCGGATTT Chr11:3032228..3032247 59.94 50
downstream ENSMUSE00000656429 Chr11:3032219..3032330 AGGTGAAGGTCCTCGGATTT Chr11:3032228..3032247 59.94 50
downstream ENSMUSE00000656471 Chr11:3032219..3032330 AGGTGAAGGTCCTCGGATTT Chr11:3032228..3032247 59.94 50
downstream ENSMUSE00000513784 Chr11:3032030..3032330 AGGTGAAGGTCCTCGGATTT Chr11:3032228..3032247 59.94 50
downstream ENSMUSE00000581629 Chr11:3031892..3032134 ACGAGCAATGCATGTACCAA Chr11:3032038..3032057 60.14 45
downstream ENSMUSE00000656428 Chr11:3031853..3032134 ACGAGCAATGCATGTACCAA Chr11:3032038..3032057 60.14 45
downstream ENSMUSE00000682608 Chr11:3031853..3032134 ACGAGCAATGCATGTACCAA Chr11:3032038..3032057 60.14 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGGGAGATGAGGAAGAGG Chr11:3074450..3074470 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGGGAGATGAGGAAGAGG Chr11:3077450..3077470 60.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023764