Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30636
Trapped Gene
AC130827.3 (ENSMUSG00000056199)
Vector Insertion
Chr 13: 62915985 - 63426095
Public Clones IST12359D7 (tigm) IST11872E8 (tigm) IST12502C1BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483158 (Chr13:62915437..62915984 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCTACGTGTTCCCTGGAG Chr13:62915793..62915812 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483158 (Chr13:62915437..62915984 +)
Downstram Exon
ENSMUSE00000681623 (Chr13:63426096..63426156 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCTACGTGTTCCCTGGAG Chr13:62915793..62915812 60.1 55 ACACCACAAAGCCCTCTCAG Chr13:63426131..63426150 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483158 Chr13:62915437..62915984 TTCCTACGTGTTCCCTGGAG Chr13:62915793..62915812 60.1 55

*** Putative Vector Insertion (Chr 13: 62915985 - 63426095) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681623 Chr13:63426096..63426156 ACACCACAAAGCCCTCTCAG Chr13:63426131..63426150 60.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCCCAGCCTTCCTAAAA Chr13:63380980..63381000 59.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAACCCCAGCCTTCCTAAAA Chr13:63380980..63381000 59.94 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056199