Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30640
Trapped Gene
Gata3 (ENSMUSG00000015619)
Vector Insertion
Chr 2: 9779048 - 9784848
Public Clones (ggtc) IST10716A4 (tigm) IST12431F8 (tigm) IST12916A8 (tigm) IST11847H1 (tigm)
IST10260E11 (tigm) IST12645A8 (tigm) IST11089G9 (tigm) IST10963H1 (tigm)
IST10260E11 (tigm) IST11089G9 (tigm) IST12286E7 (tigm) IST12360C8 (tigm)
IST12360C8HMF1 (tigm) IST12286E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153172 (Chr2:9784722..9784847 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153172 (Chr2:9784722..9784847 -)
Downstram Exon
ENSMUSE00000660912 (Chr2:9779049..9780281 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660915 Chr2:9800032..9800227 No primer for this exon
upstream ENSMUSE00000660914 Chr2:9798979..9799611 No primer for this exon
upstream ENSMUSE00000660913 Chr2:9796016..9796552 No primer for this exon
upstream ENSMUSE00000570147 Chr2:9790388..9790533 No primer for this exon
upstream ENSMUSE00000153172 Chr2:9784722..9784847 No primer for this exon
upstream ENSMUSE00000660912 Chr2:9779049..9780281 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGAAAGAGCCCTGAGAC Chr2:9784841..9784861 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTCTTCTCATCCCCAGTC Chr2:9784844..9784865 60.2 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015619