Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30647
Trapped Gene
Ptprg (ENSMUSG00000021745)
Vector Insertion
Chr 14: 12923996 - 12942489
Public Clones IST10637G1 (tigm) IST12049B8 (tigm) IST11966F9 (tigm) IST11100H12 (tigm)
IST12049B8 (tigm) IST15056F3 (tigm) IST11603E6 (tigm) IST11509E7 (tigm)
IST12651B5 (tigm) IST10262E10HMF1 (tigm) IST11903G2 (tigm) IST12930A1 (tigm)
IST10732B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483484 (Chr14:12923929..12923995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATTATCCACGGGCTGAAGG Chr14:12923961..12923980 59.92 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483484 (Chr14:12923929..12923995 +)
Downstram Exon
ENSMUSE00000484478 (Chr14:12942490..12942647 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATTATCCACGGGCTGAAGG Chr14:12923961..12923980 59.92 50 CAGGAGGTCTCGGAGAATGA Chr14:12942536..12942555 60.34 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490031 Chr14:12386046..12386846 ATCGTCCCTAGCTTGGCTTT Chr14:12386536..12386555 60.23 50
upstream ENSMUSE00000487137 Chr14:12553629..12553733 GACAGGACAGCTCAGTGCAG Chr14:12553668..12553687 59.76 60
upstream ENSMUSE00000488184 Chr14:12785230..12785409 ATGGGTTTGACAACGAGTCC Chr14:12785353..12785372 59.83 50
upstream ENSMUSE00000493040 Chr14:12795088..12795236 CCATCCTGCTGAAAGACGAT Chr14:12795091..12795110 60.22 50
upstream ENSMUSE00000486138 Chr14:12869855..12869950 GACAGCTTTCAAACGGCAAT Chr14:12869888..12869907 60.26 45
upstream ENSMUSE00000483484 Chr14:12923929..12923995 TATTATCCACGGGCTGAAGG Chr14:12923961..12923980 59.92 50

*** Putative Vector Insertion (Chr 14: 12923996 - 12942489) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000484478 Chr14:12942490..12942647 CAGGAGGTCTCGGAGAATGA Chr14:12942536..12942555 60.34 55
downstream ENSMUSE00000489229 Chr14:12954492..12954684 GCCTAGTGGGTTGTCCAAGA Chr14:12954671..12954690 60.11 55
downstream ENSMUSE00000482667 Chr14:12974898..12975082 TGCAGAGCTGTCTGGTTCAG Chr14:12974958..12974977 60.33 55
downstream ENSMUSE00000479925 Chr14:12977890..12977998 AAAGGCTATCGGGTGAGACA Chr14:12977929..12977948 59.69 50
downstream ENSMUSE00000480906 Chr14:12984530..12984579 CCTTGGAAGATCCGGGTAGT Chr14:12984557..12984576 60.32 55
downstream ENSMUSE00000485611 Chr14:12986172..12986940 TCTGTACCCTCGCTGTCCTT Chr14:12986530..12986549 59.87 55
downstream ENSMUSE00000479156 Chr14:12999259..12999391 AGCATGCCAGAGGTGTTCTT Chr14:12999286..12999305 59.87 50
downstream ENSMUSE00000476346 Chr14:13011778..13011864 CCCAGAAGAAGGCACTTCAC Chr14:13011844..13011863 59.84 55
downstream ENSMUSE00000710844 Chr14:13022457..13022590 GGAGCACACAGTGGTCATCA Chr14:13022573..13022592 60.76 55
downstream ENSMUSE00000477359 Chr14:13023196..13023287 CCGGGATGGGAATAATAGGA Chr14:13023290..13023309 60.84 50
downstream ENSMUSE00000482159 Chr14:13032236..13032327 GCTCACCGATGTGTTTACCA Chr14:13032289..13032308 59.57 50
downstream ENSMUSE00000474718 Chr14:13039798..13039894 TTGTTATCCGGATGATTGGAA Chr14:13039864..13039884 60.14 38.1
downstream ENSMUSE00000472857 Chr14:13042782..13042864 No primer for this exon
downstream ENSMUSE00000294885 Chr14:13043054..13043188 GCAATGTAGGCTTTCGCTTT Chr14:13043085..13043104 59.5 45
downstream ENSMUSE00000120438 Chr14:13044099..13044233 AAAGACGACGGACGGTGTAG Chr14:13044210..13044229 60.17 55
downstream ENSMUSE00000294867 Chr14:13046148..13046320 AGATGACCTCCTCACGAAGG Chr14:13046279..13046298 59.25 55
downstream ENSMUSE00000471722 Chr14:13047702..13047837 ACAATGTAGGTGCCTGTCCTG Chr14:13047736..13047756 60.04 52.38
downstream ENSMUSE00000469697 Chr14:13048376..13048522 CTTTTCCAGCCGTGTCTTTC Chr14:13048516..13048535 59.85 50
downstream ENSMUSE00000467625 Chr14:13051453..13051546 GGCACAACAGACGAGTTCCT Chr14:13051547..13051566 60.31 55
downstream ENSMUSE00000464689 Chr14:13052523..13052599 No primer for this exon
downstream ENSMUSE00000351959 Chr14:13053106..13053234 GGCAGCATGACAATGATCTG Chr14:13053221..13053240 60.23 50
downstream ENSMUSE00000462585 Chr14:13057984..13058130 TCGGCCAGTACACAAACTCA Chr14:13058014..13058033 60.3 50
downstream ENSMUSE00000460554 Chr14:13058826..13058968 ACACTGAAAGTGCCGAACCT Chr14:13058864..13058883 59.77 50
downstream ENSMUSE00000515706 Chr14:13069543..13069678 ACAAGGTGGTAAGGGCACAC Chr14:13069592..13069611 59.89 55
downstream ENSMUSE00000519838 Chr14:13070241..13071077 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55
downstream ENSMUSE00000714956 Chr14:13070241..13074555 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGCTAAGAGCACAGGAT Chr14:12927017..12927037 59.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGCTAAGAGCACAGGAT Chr14:12927017..12927037 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021745