Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30653
Trapped Gene
D430041B17Rik (ENSMUSG00000053550)
Vector Insertion
Chr 7: 4777153 - 4781878
Public Clones IST12260A9 (tigm) IST12260B10BBF1 (tigm) IST12042D8 (tigm) IST10222A9 (tigm)
IST13409A6 (tigm) IST10516C5 (tigm) IST13244G12 (tigm) IST10573H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713592 (Chr7:4779629..4781877 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCTTTCTTTGCGTGACC Chr7:4780041..4780060 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713592 (Chr7:4779629..4781877 -)
Downstram Exon
ENSMUSE00000721749 (Chr7:4777154..4781877 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCTTTCTTTGCGTGACC Chr7:4780041..4780060 60 50 GGTCACGCAAAGAAAGAAGC Chr7:4780019..4780038 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711337 Chr7:4787646..4787776 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000716075 Chr7:4787646..4787857 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000721807 Chr7:4787646..4787776 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000538435 Chr7:4785832..4785986 CAAGGACACCCAAGAACCTT Chr7:4785860..4785879 59.04 50
upstream ENSMUSE00000718468 Chr7:4785832..4785986 CAAGGACACCCAAGAACCTT Chr7:4785860..4785879 59.04 50
upstream ENSMUSE00000417222 Chr7:4783275..4783325 CTGCACTACAACGTCAACAGC Chr7:4783300..4783320 59.57 52.38
upstream ENSMUSE00000417217 Chr7:4782361..4782510 ATCTTCCCCCGTCCTATGAG Chr7:4782410..4782429 60.28 55
upstream ENSMUSE00000417238 Chr7:4780076..4781877 AAAGTTGGGCATGTGTAGCC Chr7:4780298..4780317 60 50
upstream ENSMUSE00000713592 Chr7:4779629..4781877 GCTTCTTTCTTTGCGTGACC Chr7:4780041..4780060 60 50
upstream ENSMUSE00000721749 Chr7:4777154..4781877 GCTTCTTTCTTTGCGTGACC Chr7:4780041..4780060 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCCCAGCTGAGAAAGAT Chr7:4781865..4781885 60.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCTCCCAGAATCCATGT Chr7:4781845..4781865 59.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053550