Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30671
Trapped Gene
Etfa (ENSMUSG00000032314)
Vector Insertion
Chr 9: 55312600 - 55330163
Public Clones IST12032A2BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218622 (Chr9:55330080..55330162 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAAGTTGGTCAGACAGGA Chr9:55330095..55330114 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218622 (Chr9:55330080..55330162 -)
Downstram Exon
ENSMUSE00000218621 (Chr9:55312601..55312666 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAAGTTGGTCAGACAGGA Chr9:55330095..55330114 60.44 50 CTGTCCTTCATCCCAGCTAAA Chr9:55312583..55312603 59.32 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361109 Chr9:55359838..55360003 TTCGGGTCTCTGGTAGAGGA Chr9:55359964..55359983 59.8 55
upstream ENSMUSE00000218636 Chr9:55347825..55347971 GGAGGTGAAGTGTCCTGCTT Chr9:55347850..55347869 59.31 55
upstream ENSMUSE00000218632 Chr9:55343549..55343630 TAGCTGGCGTAGCAAAGGTT Chr9:55343589..55343608 60.04 50
upstream ENSMUSE00000218626 Chr9:55343369..55343451 ACATCTGTGCTGGAGCGTCT Chr9:55343381..55343400 61.04 55
upstream ENSMUSE00000218619 Chr9:55336637..55336736 CCTTCTGCCCAGAGTAGCTG Chr9:55336715..55336734 60.15 60
upstream ENSMUSE00000218628 Chr9:55335207..55335317 TGCAGCAACAAGTGGAGGTA Chr9:55335225..55335244 60.45 50
upstream ENSMUSE00000218623 Chr9:55334509..55334610 TGACAAAAAGTGACCGACCA Chr9:55334543..55334562 60.13 45
upstream ENSMUSE00000218618 Chr9:55333077..55333145 CTGCTGTATGACCTGGCAGA Chr9:55333094..55333113 60.01 55
upstream ENSMUSE00000218622 Chr9:55330080..55330162 TGCAAGTTGGTCAGACAGGA Chr9:55330095..55330114 60.44 50
upstream ENSMUSE00000218621 Chr9:55312601..55312666 TAGCTGGGATGAAGGACAGC Chr9:55312604..55312623 60.36 55

*** Putative Vector Insertion (Chr 9: 55312600 - 55330163) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218620 Chr9:55309427..55309507 ATCTGCCACCTGGAAAATTG Chr9:55309432..55309451 59.93 45
downstream ENSMUSE00000404160 Chr9:55302329..55302569 CAAAAGGCATTCTAGCTGCTG Chr9:55302403..55302423 60.16 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTTTCAGTTGGTGCTTC Chr9:55327151..55327171 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTTTCAGTTGGTGCTTC Chr9:55327151..55327171 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032314