Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30679
Trapped Gene
Phlppl (ENSMUSG00000031732)
Vector Insertion
Chr 8: 112400984 - 112419407
Public Clones IST11882F11BBF1 (tigm) IST11882F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335447 (Chr8:112400703..112400983 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACGACCACTGCCACTACA Chr8:112400824..112400843 60.23 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335447 (Chr8:112400703..112400983 +)
Downstram Exon
ENSMUSE00000323676 (Chr8:112419408..112419541 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACGACCACTGCCACTACA Chr8:112400824..112400843 60.23 55 GCTGAGGTCAGGGTTCGTAG Chr8:112419522..112419541 59.87 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336355 Chr8:112392546..112392617 GAGGGATTCGGGTCCTAAAG Chr8:112392598..112392617 59.9 55
upstream ENSMUSE00000335447 Chr8:112400703..112400983 ACACGACCACTGCCACTACA Chr8:112400824..112400843 60.23 55

*** Putative Vector Insertion (Chr 8: 112400984 - 112419407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323676 Chr8:112419408..112419541 GCTGAGGTCAGGGTTCGTAG Chr8:112419522..112419541 59.87 60
downstream ENSMUSE00000323652 Chr8:112428140..112428330 GATCCATCTGGCATGGTTTT Chr8:112428163..112428182 59.76 45
downstream ENSMUSE00000323632 Chr8:112431395..112431520 CCGTTGCCATCTCTGGTACT Chr8:112431511..112431530 60.13 55
downstream ENSMUSE00000323608 Chr8:112432933..112433087 GAGGTCCACAGTGCTCATCC Chr8:112432968..112432987 60.69 60
downstream ENSMUSE00000323577 Chr8:112435588..112435734 GTTCAGGCCCTTCAGTTGAG Chr8:112435615..112435634 59.84 55
downstream ENSMUSE00000323549 Chr8:112436105..112436335 GGGATGTGACGAAAATCGTT Chr8:112436221..112436240 59.8 45
downstream ENSMUSE00000323525 Chr8:112437469..112437671 GCAAATCCATGTGCGTGATA Chr8:112437542..112437561 60.5 45
downstream ENSMUSE00000323505 Chr8:112443981..112444041 GGGAGAGCTCCAAAGAAGTG Chr8:112444043..112444062 59.01 55
downstream ENSMUSE00000323480 Chr8:112446716..112446811 GGGACACACTCCAGCAAGTT Chr8:112446739..112446758 60.16 55
downstream ENSMUSE00000323457 Chr8:112449650..112449805 TTTAAGGCCTTGGAGAAGAGC Chr8:112449807..112449827 59.97 47.62
downstream ENSMUSE00000323435 Chr8:112452355..112452555 CAGAAGGTTGCTGGTCAGGT Chr8:112452469..112452488 60.3 55
downstream ENSMUSE00000323419 Chr8:112457031..112457193 TGCAGGATCTCTGGGAAGAT Chr8:112457180..112457199 59.76 50
downstream ENSMUSE00000323398 Chr8:112457859..112457989 GGCAGAGCTTCTGGAATTAGG Chr8:112457916..112457936 60.35 52.38
downstream ENSMUSE00000323380 Chr8:112458533..112458643 TGGCTCCAGAAGGTTGATGT Chr8:112458613..112458632 60.66 50
downstream ENSMUSE00000212497 Chr8:112459369..112459563 CAGCAGACGAGGGAGTTCTT Chr8:112459474..112459493 59.6 55
downstream ENSMUSE00000212495 Chr8:112460912..112461143 CTACTTGTTGGGTCGGCAGT Chr8:112460998..112461017 60.17 55
downstream ENSMUSE00000382966 Chr8:112463654..112464808 TTGGCTTGGGAGTATCCTTG Chr8:112464041..112464060 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGATCTGGTCAGGTGAGG Chr8:112406971..112406991 59.64 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGATCTGGTCAGGTGAGG Chr8:112406971..112406991 59.64 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031732