Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30680
Trapped Gene
3200002M19Rik (ENSMUSG00000030649)
Vector Insertion
Chr 7: 109029917 - 109044941
Public Clones IST12272D1 (tigm) IST12756E1 (tigm) IST11879H9BBF1 (tigm) IST14848F3 (tigm)
IST11727G7 (tigm) IST10971D8 (tigm) IST11727G7 (tigm) IST10131E8 (tigm)
IST11389B4BBF1 (tigm) IST13608D5 (tigm) IST14579C1 (tigm) IST11389B4 (tigm)
IST14350E6 (tigm) IST14430B12 (tigm) IST12272D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671730 (Chr7:109029839..109029916 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTGGAAGAGAACATCACC Chr7:109029857..109029876 59.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671730 (Chr7:109029839..109029916 +)
Downstram Exon
ENSMUSE00000671727 (Chr7:109044942..109044964 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTGGAAGAGAACATCACC Chr7:109029857..109029876 59.66 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671730 Chr7:109029839..109029916 GGCTGGAAGAGAACATCACC Chr7:109029857..109029876 59.66 55

*** Putative Vector Insertion (Chr 7: 109029917 - 109044941) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000671738 Chr7:109044854..109044964 GAATCCGGGACTCACTAACG Chr7:109044898..109044917 59.55 55
downstream ENSMUSE00000671721 Chr7:109044930..109044964 No primer for this exon
downstream ENSMUSE00000671727 Chr7:109044942..109044964 No primer for this exon
downstream ENSMUSE00000671732 Chr7:109046246..109046331 AACCTCTCTGGGCCTCAGTT Chr7:109046276..109046295 60.25 55
downstream ENSMUSE00000589945 Chr7:109046247..109046301 AACCTCTCTGGGCCTCAGTT Chr7:109046276..109046295 60.25 55
downstream ENSMUSE00000716776 Chr7:109046247..109046331 AACCTCTCTGGGCCTCAGTT Chr7:109046276..109046295 60.25 55
downstream ENSMUSE00000718870 Chr7:109046247..109046331 AACCTCTCTGGGCCTCAGTT Chr7:109046276..109046295 60.25 55
downstream ENSMUSE00000721871 Chr7:109046247..109046331 AACCTCTCTGGGCCTCAGTT Chr7:109046276..109046295 60.25 55
downstream ENSMUSE00000528854 Chr7:109046456..109046585 AGAGTGACGGGAACAAGGTG Chr7:109046493..109046512 60.15 55
downstream ENSMUSE00000633258 Chr7:109046456..109046585 AGAGTGACGGGAACAAGGTG Chr7:109046493..109046512 60.15 55
downstream ENSMUSE00000720972 Chr7:109046456..109046585 AGAGTGACGGGAACAAGGTG Chr7:109046493..109046512 60.15 55
downstream ENSMUSE00000633259 Chr7:109046461..109046585 AGAGTGACGGGAACAAGGTG Chr7:109046493..109046512 60.15 55
downstream ENSMUSE00000222469 Chr7:109047068..109047127 TCTTTCTCTGCGATGCTTTG Chr7:109047093..109047112 59.3 45
downstream ENSMUSE00000201583 Chr7:109047414..109047551 TCCATGTCTTGCATGTCCTC Chr7:109047505..109047524 59.64 50
downstream ENSMUSE00000370783 Chr7:109047708..109047994 CATCCACTGGTCCTGATCCT Chr7:109047752..109047771 59.92 55
downstream ENSMUSE00000671726 Chr7:109047708..109047755 CATCCACTGGTCCTGATCCT Chr7:109047752..109047771 59.92 55
downstream ENSMUSE00000671731 Chr7:109047708..109048057 GAGGGCTAGAAAGGGACCAC Chr7:109048028..109048047 60.07 60
downstream ENSMUSE00000671733 Chr7:109047708..109048054 GAGGGCTAGAAAGGGACCAC Chr7:109048028..109048047 60.07 60
downstream ENSMUSE00000633257 Chr7:109049446..109050359 GGTAACCAGCCACAAATGCT Chr7:109050296..109050315 60 50
downstream ENSMUSE00000671722 Chr7:109049446..109049580 TTCATGAGGGACTCCCATTC Chr7:109049552..109049571 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCGTCTGTCCCCATACCT Chr7:109035919..109035939 59.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGTCTGTCCCCATACCT Chr7:109035919..109035939 59.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030649