Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30685
Trapped Gene
AC144776.2 (ENSMUSG00000075007)
Vector Insertion
Chr 16: 57353572 - 57506711
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) IST11771G9 (tigm) IST11979F3 (tigm) IST14279G8 (tigm) IST12377A11 (tigm)
IST10949D8 (tigm) IST14291C12 (tigm) IST14601D11 (tigm) IST14238E9 (tigm)
IST10416H2 (tigm) IST14749A11 (tigm) IST11628A9 (tigm) IST10557F12 (tigm)
IST14639E11 (tigm) IST10060D7 (tigm) IST15082A8 (tigm) IST10187C8 (tigm)
IST10697D2 (tigm) IST11751F8 (tigm) IST10067F8 (tigm) IST13756D10 (tigm)
IST13837G6 (tigm) IST12656D3 (tigm) IST14989G6 (tigm) IST13858H12 (tigm)
IST10020D4 (tigm) IST12345C7 (tigm) IST14006C9 (tigm) IST14283A1 (tigm)
IST11161C1 (tigm) IST11431D1 (tigm) IST13421H9 (tigm) IST14736G9 (tigm)
IST12538H4 (tigm) IST12715E12 (tigm) IST10060C7 (tigm) IST10536B8 (tigm)
IST13740G8 (tigm) IST12371H4 (tigm) IST14439D10 (tigm) IST13518E1 (tigm)
IST11058H8 (tigm) IST13087A7 (tigm) IST12530A12 (tigm) IST14165G8 (tigm)
IST14518E5 (tigm) IST10413H2 (tigm) IST14741D7 (tigm) IST14233A3 (tigm)
IST10119E2 (tigm) IST11570E5 (tigm) IST12135D11 (tigm) IST15077F9 (tigm)
IST11138G3 (tigm) IST11590A2 (tigm) IST10798E12 (tigm) IST11093F7 (tigm)
IST13368C2 (tigm) IST12751C11 (tigm) IST14916G12 (tigm) IST14724C4 (tigm)
IST11522G9 (tigm) IST12654A4 (tigm) IST10717F12 (tigm) IST12657G11 (tigm)
IST10301D9 (tigm) IST10076H8 (tigm) IST10067G8 (tigm) IST10633D5 (tigm)
IST12362C2 (tigm) IST11200B2 (tigm) IST11373A8 (tigm) IST12942H11 (tigm)
IST11932H11 (tigm) IST13744A6 (tigm) IST10204B2 (tigm) IST10533B4 (tigm)
IST11814F5 (tigm) IST14676F2 (tigm) IST10232E12 (tigm) IST10852A9 (tigm)
IST13788B5 (tigm) IST10781D6 (tigm) IST11068G12 (tigm) IST11365A4 (tigm)
IST10146B10 (tigm) IST14849C10 (tigm) IST12233D6 (tigm) IST14190H2 (tigm)
IST14745A8 (tigm) IST15077G3 (tigm) IST10046F9 (tigm) IST13870F10 (tigm)
IST10481E5 (tigm) IST13210C2 (tigm) IST13941C4 (tigm) IST14724C4 (tigm)
IST10219E12 (tigm) IST11053F7 (tigm) IST11715A10 (tigm) IST12147D7 (tigm)
IST14973B12 (tigm) IST13160E1 (tigm) IST10235C6 (tigm) IST11197F8 (tigm)
IST11797C12 (tigm) IST10597A9 (tigm) IST11165E1 (tigm) IST10443C6 (tigm)
IST10101A6 (tigm) IST10524D3 (tigm) IST14243B8 (tigm) IST10013B11 (tigm)
IST14245A4 (tigm) IST14432G8 (tigm) IST12123A6 (tigm) IST13194E9 (tigm)
IST12370A4 (tigm) IST14752G4 (tigm) IST13787A11 (tigm) IST11267C10BBF1 (tigm)
IST13999A8 (tigm) IST14931B11 (tigm) IST10119D1 (tigm) IST11431D1 (tigm)
IST14737H4 (tigm) IST10626D8 (tigm) IST10717F12 (tigm) IST10345F4 (tigm)
IST10700C5 (tigm) IST11138G3 (tigm) IST10228F10 (tigm) IST14982H4 (tigm)
IST10720H12 (tigm) IST11994G11 (tigm) IST10995H1 (tigm) IST13670E8 (tigm)
IST12337D10 (tigm) IST11223F1 (tigm) IST12363B2 (tigm) IST10236A10 (tigm)
IST11304B10 (tigm) IST12377A12 (tigm) IST12377A11 (tigm) IST13434D6 (tigm)
IST14019G12 (tigm) IST14771B1 (tigm) IST11245F10 (tigm) IST14981G2 (tigm)
IST13973E7 (tigm) IST13436D11 (tigm) IST12519B8 (tigm) IST11942H8 (tigm)
IST14850D11 (tigm) IST12418E11 (tigm) IST10554D12 (tigm) IST13641C7 (tigm)
IST10303B8 (tigm) IST14121H5 (tigm) IST15082A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699073 (Chr16:57353390..57353571 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGGTCCCTGGTTACATA Chr16:57353400..57353419 59.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699073 (Chr16:57353390..57353571 +)
Downstram Exon
ENSMUSE00000642918 (Chr16:57506712..57506967 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGGTCCCTGGTTACATA Chr16:57353400..57353419 59.67 55 CTGACTCACACGAGGGGTCT Chr16:57506851..57506870 60.31 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699073 Chr16:57353390..57353571 CCCTGGTCCCTGGTTACATA Chr16:57353400..57353419 59.67 55

*** Putative Vector Insertion (Chr 16: 57353572 - 57506711) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642918 Chr16:57506712..57506967 CTGACTCACACGAGGGGTCT Chr16:57506851..57506870 60.31 60
downstream ENSMUSE00000642917 Chr16:57507662..57507835 CAGCCCTTAAAATGCCAATG Chr16:57507698..57507717 60.45 45
downstream ENSMUSE00000642916 Chr16:57513379..57513557 CAAGATCCGCCTGTGAGATT Chr16:57513429..57513448 60.22 50
downstream ENSMUSE00000699064 Chr16:57515019..57515803 ACAAGCGAAGCAAAGGAAGA Chr16:57515212..57515231 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCATGTGCACCATTTGA Chr16:57428555..57428575 59.82 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGAGGGTGGGAAAATAAGA Chr16:57428551..57428572 60.44 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075007